\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211898266:

Variant ID: vg1211898266 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11898266
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTGTCTCTAAGCATCAGAAGAAGAAAACACAAAAGAGGTAAGCAAATGACAATACATTCTTTACTGAAGATACTAGCAGCATAATGCTATACGACTG[T/C]
TACTTATTTCAGTTTCTTGCAAGAACTACTAATGGAAGGATGTGCATCCAGTAAAAATAAACTCAATGGAGCAGACCATGAACATGATTACATGAATGGA

Reverse complement sequence

TCCATTCATGTAATCATGTTCATGGTCTGCTCCATTGAGTTTATTTTTACTGGATGCACATCCTTCCATTAGTAGTTCTTGCAAGAAACTGAAATAAGTA[A/G]
CAGTCGTATAGCATTATGCTGCTAGTATCTTCAGTAAAGAATGTATTGTCATTTGCTTACCTCTTTTGTGTTTTCTTCTTCTGATGCTTAGAGACACAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 0.20% 3.36% 5.88% NA
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 70.80% 0.50% 10.32% 18.39% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 91.00% 0.00% 1.69% 7.30% NA
Tropical Japonica  504 40.50% 1.40% 25.20% 32.94% NA
Japonica Intermediate  241 70.10% 0.00% 6.64% 23.24% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211898266 T -> C LOC_Os12g20370.1 upstream_gene_variant ; 3077.0bp to feature; MODIFIER silent_mutation Average:21.762; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1211898266 T -> C LOC_Os12g20380.1 upstream_gene_variant ; 2524.0bp to feature; MODIFIER silent_mutation Average:21.762; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1211898266 T -> C LOC_Os12g20370-LOC_Os12g20380 intergenic_region ; MODIFIER silent_mutation Average:21.762; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1211898266 T -> DEL N N silent_mutation Average:21.762; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211898266 NA 5.68E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211898266 4.57E-06 4.57E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211898266 8.72E-06 8.72E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211898266 8.83E-06 8.83E-06 mr1412_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211898266 NA 5.97E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211898266 1.92E-06 3.54E-08 mr1738_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211898266 NA 1.92E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211898266 8.36E-06 8.36E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211898266 3.47E-06 3.47E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251