\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211773333:

Variant ID: vg1211773333 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11773333
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGACAATATTGGCCTATATTGGTACACGTGTGTGCGAGAAAAACTTCAAAAATCACCAAAACATGATTTTTGGACATATTGGAGTATGTTGGGTGAGTC[T/C]
GTGTCGAAAAATCACTCCGTGATTCGCGCGGCTTATTTTTCTCAATTAATGCAAATATTGGCACACGTGGGTGCGATGTTTTTCACCGAAATGAAAAAGT

Reverse complement sequence

ACTTTTTCATTTCGGTGAAAAACATCGCACCCACGTGTGCCAATATTTGCATTAATTGAGAAAAATAAGCCGCGCGAATCACGGAGTGATTTTTCGACAC[A/G]
GACTCACCCAACATACTCCAATATGTCCAAAAATCATGTTTTGGTGATTTTTGAAGTTTTTCTCGCACACACGTGTACCAATATAGGCCAATATTGTCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 1.40% 6.39% 8.32% NA
All Indica  2759 87.60% 1.80% 7.07% 3.55% NA
All Japonica  1512 80.10% 0.30% 1.85% 17.72% NA
Aus  269 70.60% 2.20% 21.93% 5.20% NA
Indica I  595 98.30% 0.00% 1.51% 0.17% NA
Indica II  465 75.50% 3.40% 12.90% 8.17% NA
Indica III  913 87.70% 2.10% 7.12% 3.07% NA
Indica Intermediate  786 86.40% 1.90% 7.76% 3.94% NA
Temperate Japonica  767 95.00% 0.10% 0.65% 4.17% NA
Tropical Japonica  504 57.70% 0.80% 3.57% 37.90% NA
Japonica Intermediate  241 79.30% 0.00% 2.07% 18.67% NA
VI/Aromatic  96 70.80% 4.20% 17.71% 7.29% NA
Intermediate  90 90.00% 0.00% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211773333 T -> C LOC_Os12g20190.1 upstream_gene_variant ; 3016.0bp to feature; MODIFIER silent_mutation Average:39.168; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1211773333 T -> C LOC_Os12g20190-LOC_Os12g20200 intergenic_region ; MODIFIER silent_mutation Average:39.168; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1211773333 T -> DEL N N silent_mutation Average:39.168; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211773333 NA 8.04E-14 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1211773333 NA 3.99E-08 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 1.30E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 8.79E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 8.53E-09 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 5.55E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 8.36E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 6.89E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 2.19E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 1.17E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 3.94E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 4.20E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 5.37E-07 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 9.30E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 1.53E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 1.34E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 6.44E-06 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 8.53E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 2.93E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 1.86E-10 mr1892_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 9.74E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211773333 NA 7.44E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251