Search for Variation information by Variation ID:
Detailed information for vg1211536265:
| Variant ID: vg1211536265 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 11536265 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CAGATCAAGTGGTATGCCCCCATCTCCAAGTGAATGGTGCTCAAGCTCCTCTCGTTGGGACTTGGGTGAAATCACTAGGAGAATGGACACCCTTGATATG[C/T,A]
AGACAGGGGAGATCCAGTACAACCTCGCGGAACGCATAGCTCAAATGCAAGAATGGCAACAATCTGCTGATGCTCAGTTCGCCAACTTCAACAACATGAT
Reverse complement sequence
ATCATGTTGTTGAAGTTGGCGAACTGAGCATCAGCAGATTGTTGCCATTCTTGCATTTGAGCTATGCGTTCCGCGAGGTTGTACTGGATCTCCCCTGTCT[G/A,T]
CATATCAAGGGTGTCCATTCTCCTAGTGATTTCACCCAAGTCCCAACGAGAGGAGCTTGAGCACCATTCACTTGGAGATGGGGGCATACCACTTGATCTG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.70% | 6.00% | 3.20% | 6.03% | A: 0.06% |
| All Indica | 2759 | 97.90% | 0.30% | 1.20% | 0.54% | A: 0.11% |
| All Japonica | 1512 | 61.60% | 17.10% | 6.02% | 15.21% | NA |
| Aus | 269 | 84.80% | 0.40% | 3.35% | 11.52% | NA |
| Indica I | 595 | 97.80% | 0.30% | 1.51% | 0.34% | NA |
| Indica II | 465 | 96.60% | 0.90% | 1.72% | 0.86% | NA |
| Indica III | 913 | 98.50% | 0.00% | 1.10% | 0.11% | A: 0.33% |
| Indica Intermediate | 786 | 98.10% | 0.10% | 0.76% | 1.02% | NA |
| Temperate Japonica | 767 | 90.70% | 1.70% | 0.78% | 6.78% | NA |
| Tropical Japonica | 504 | 25.00% | 35.50% | 14.09% | 25.40% | NA |
| Japonica Intermediate | 241 | 45.60% | 27.80% | 5.81% | 20.75% | NA |
| VI/Aromatic | 96 | 64.60% | 11.50% | 17.71% | 6.25% | NA |
| Intermediate | 90 | 90.00% | 5.60% | 1.11% | 3.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211536265 | C -> DEL | LOC_Os12g19790.1 | N | frameshift_variant | Average:17.773; most accessible tissue: Zhenshan97 young leaf, score: 29.503 | N | N | N | N |
| vg1211536265 | C -> A | LOC_Os12g19790.1 | missense_variant ; p.Gln624Lys; MODERATE | nonsynonymous_codon ; Q624K | Average:17.773; most accessible tissue: Zhenshan97 young leaf, score: 29.503 | benign  |
1.245 |
DELETERIOUS | 0.01 |
| vg1211536265 | C -> T | LOC_Os12g19790.1 | stop_gained ; p.Gln624*; HIGH | stop_gained | Average:17.773; most accessible tissue: Zhenshan97 young leaf, score: 29.503 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211536265 | NA | 2.71E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211536265 | 2.74E-06 | NA | mr1676 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211536265 | NA | 1.48E-11 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211536265 | NA | 4.35E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211536265 | NA | 5.65E-08 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211536265 | NA | 9.53E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |