\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211536265:

Variant ID: vg1211536265 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11536265
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGATCAAGTGGTATGCCCCCATCTCCAAGTGAATGGTGCTCAAGCTCCTCTCGTTGGGACTTGGGTGAAATCACTAGGAGAATGGACACCCTTGATATG[C/T,A]
AGACAGGGGAGATCCAGTACAACCTCGCGGAACGCATAGCTCAAATGCAAGAATGGCAACAATCTGCTGATGCTCAGTTCGCCAACTTCAACAACATGAT

Reverse complement sequence

ATCATGTTGTTGAAGTTGGCGAACTGAGCATCAGCAGATTGTTGCCATTCTTGCATTTGAGCTATGCGTTCCGCGAGGTTGTACTGGATCTCCCCTGTCT[G/A,T]
CATATCAAGGGTGTCCATTCTCCTAGTGATTTCACCCAAGTCCCAACGAGAGGAGCTTGAGCACCATTCACTTGGAGATGGGGGCATACCACTTGATCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 6.00% 3.20% 6.03% A: 0.06%
All Indica  2759 97.90% 0.30% 1.20% 0.54% A: 0.11%
All Japonica  1512 61.60% 17.10% 6.02% 15.21% NA
Aus  269 84.80% 0.40% 3.35% 11.52% NA
Indica I  595 97.80% 0.30% 1.51% 0.34% NA
Indica II  465 96.60% 0.90% 1.72% 0.86% NA
Indica III  913 98.50% 0.00% 1.10% 0.11% A: 0.33%
Indica Intermediate  786 98.10% 0.10% 0.76% 1.02% NA
Temperate Japonica  767 90.70% 1.70% 0.78% 6.78% NA
Tropical Japonica  504 25.00% 35.50% 14.09% 25.40% NA
Japonica Intermediate  241 45.60% 27.80% 5.81% 20.75% NA
VI/Aromatic  96 64.60% 11.50% 17.71% 6.25% NA
Intermediate  90 90.00% 5.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211536265 C -> DEL LOC_Os12g19790.1 N frameshift_variant Average:17.773; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg1211536265 C -> A LOC_Os12g19790.1 missense_variant ; p.Gln624Lys; MODERATE nonsynonymous_codon ; Q624K Average:17.773; most accessible tissue: Zhenshan97 young leaf, score: 29.503 benign 1.245 DELETERIOUS 0.01
vg1211536265 C -> T LOC_Os12g19790.1 stop_gained ; p.Gln624*; HIGH stop_gained Average:17.773; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211536265 NA 2.71E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211536265 2.74E-06 NA mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211536265 NA 1.48E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211536265 NA 4.35E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211536265 NA 5.65E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211536265 NA 9.53E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251