\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211144062:

Variant ID: vg1211144062 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11144062
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, G: 0.39, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAAGCATTTCTAACATAAGGCTGACCACCGTACGAGGCCTAAACATCGCAGCGGGAAAACAGTGTTTGCTATGGTTAAAGATCTTAAAATAGTGTTCG[T/G]
AAAGGGGCCTGGAAGCCAGCCTATAGAGAGCGAAGATGGTCACGCGGCGATGTGAAAAAAGAACTCTATATTTTGGGAGTTACCCTATTGGGAATTCTTG

Reverse complement sequence

CAAGAATTCCCAATAGGGTAACTCCCAAAATATAGAGTTCTTTTTTCACATCGCCGCGTGACCATCTTCGCTCTCTATAGGCTGGCTTCCAGGCCCCTTT[A/C]
CGAACACTATTTTAAGATCTTTAACCATAGCAAACACTGTTTTCCCGCTGCGATGTTTAGGCCTCGTACGGTGGTCAGCCTTATGTTAGAAATGCTTGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.30% 12.30% 1.12% 69.28% NA
All Indica  2759 4.50% 20.40% 1.45% 73.69% NA
All Japonica  1512 44.20% 0.50% 0.53% 54.83% NA
Aus  269 0.00% 0.70% 0.74% 98.51% NA
Indica I  595 2.90% 2.70% 2.35% 92.10% NA
Indica II  465 4.70% 36.10% 0.22% 58.92% NA
Indica III  913 4.10% 21.80% 1.53% 72.62% NA
Indica Intermediate  786 6.10% 22.80% 1.40% 69.72% NA
Temperate Japonica  767 78.40% 0.40% 0.52% 20.73% NA
Tropical Japonica  504 2.00% 0.20% 0.79% 97.02% NA
Japonica Intermediate  241 23.70% 1.20% 0.00% 75.10% NA
VI/Aromatic  96 2.10% 0.00% 1.04% 96.88% NA
Intermediate  90 27.80% 10.00% 2.22% 60.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211144062 T -> DEL N N silent_mutation Average:6.84; most accessible tissue: Callus, score: 28.563 N N N N
vg1211144062 T -> G LOC_Os12g19200.1 upstream_gene_variant ; 4517.0bp to feature; MODIFIER silent_mutation Average:6.84; most accessible tissue: Callus, score: 28.563 N N N N
vg1211144062 T -> G LOC_Os12g19180.1 downstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:6.84; most accessible tissue: Callus, score: 28.563 N N N N
vg1211144062 T -> G LOC_Os12g19190.1 intron_variant ; MODIFIER silent_mutation Average:6.84; most accessible tissue: Callus, score: 28.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211144062 NA 1.06E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 1.20E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 6.22E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 2.92E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 7.36E-08 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 2.66E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 8.33E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 2.94E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 8.57E-15 mr1722_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 1.41E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 1.93E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211144062 NA 2.08E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251