Variant ID: vg1211144062 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 11144062 |
Reference Allele: T | Alternative Allele: G |
Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, G: 0.39, others allele: 0.00, population size: 81. )
GGCAAGCATTTCTAACATAAGGCTGACCACCGTACGAGGCCTAAACATCGCAGCGGGAAAACAGTGTTTGCTATGGTTAAAGATCTTAAAATAGTGTTCG[T/G]
AAAGGGGCCTGGAAGCCAGCCTATAGAGAGCGAAGATGGTCACGCGGCGATGTGAAAAAAGAACTCTATATTTTGGGAGTTACCCTATTGGGAATTCTTG
CAAGAATTCCCAATAGGGTAACTCCCAAAATATAGAGTTCTTTTTTCACATCGCCGCGTGACCATCTTCGCTCTCTATAGGCTGGCTTCCAGGCCCCTTT[A/C]
CGAACACTATTTTAAGATCTTTAACCATAGCAAACACTGTTTTCCCGCTGCGATGTTTAGGCCTCGTACGGTGGTCAGCCTTATGTTAGAAATGCTTGCC
Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 17.30% | 12.30% | 1.12% | 69.28% | NA |
All Indica | 2759 | 4.50% | 20.40% | 1.45% | 73.69% | NA |
All Japonica | 1512 | 44.20% | 0.50% | 0.53% | 54.83% | NA |
Aus | 269 | 0.00% | 0.70% | 0.74% | 98.51% | NA |
Indica I | 595 | 2.90% | 2.70% | 2.35% | 92.10% | NA |
Indica II | 465 | 4.70% | 36.10% | 0.22% | 58.92% | NA |
Indica III | 913 | 4.10% | 21.80% | 1.53% | 72.62% | NA |
Indica Intermediate | 786 | 6.10% | 22.80% | 1.40% | 69.72% | NA |
Temperate Japonica | 767 | 78.40% | 0.40% | 0.52% | 20.73% | NA |
Tropical Japonica | 504 | 2.00% | 0.20% | 0.79% | 97.02% | NA |
Japonica Intermediate | 241 | 23.70% | 1.20% | 0.00% | 75.10% | NA |
VI/Aromatic | 96 | 2.10% | 0.00% | 1.04% | 96.88% | NA |
Intermediate | 90 | 27.80% | 10.00% | 2.22% | 60.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1211144062 | T -> DEL | N | N | silent_mutation | Average:6.84; most accessible tissue: Callus, score: 28.563 | N | N | N | N |
vg1211144062 | T -> G | LOC_Os12g19200.1 | upstream_gene_variant ; 4517.0bp to feature; MODIFIER | silent_mutation | Average:6.84; most accessible tissue: Callus, score: 28.563 | N | N | N | N |
vg1211144062 | T -> G | LOC_Os12g19180.1 | downstream_gene_variant ; 2457.0bp to feature; MODIFIER | silent_mutation | Average:6.84; most accessible tissue: Callus, score: 28.563 | N | N | N | N |
vg1211144062 | T -> G | LOC_Os12g19190.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.84; most accessible tissue: Callus, score: 28.563 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1211144062 | NA | 1.06E-08 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 1.20E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 6.22E-09 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 2.92E-07 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 7.36E-08 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 2.66E-10 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 8.33E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 2.94E-09 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 8.57E-15 | mr1722_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 1.41E-06 | mr1722_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 1.93E-11 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211144062 | NA | 2.08E-06 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |