\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211077849:

Variant ID: vg1211077849 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11077849
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTTGCGAAAATTTTTTGAGAACTAAACAGGGCCTAAGGTGAAATGAAAATTTTTGGGTGTCACATCGGACGTTTGACCGGATGTCAGAAGTGGTTTT[C/T]
GGACACGAATGAAAAAACTAATTTCATAACTCGTCTGGAAACCGCGAGACGAATCTTTTGAGCCTAATTAATCCGTCATTAGCACATGTAGGTTACTGTA

Reverse complement sequence

TACAGTAACCTACATGTGCTAATGACGGATTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTCCAGACGAGTTATGAAATTAGTTTTTTCATTCGTGTCC[G/A]
AAAACCACTTCTGACATCCGGTCAAACGTCCGATGTGACACCCAAAAATTTTCATTTCACCTTAGGCCCTGTTTAGTTCTCAAAAAATTTTCGCAAAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 34.30% 0.08% 0.00% NA
All Indica  2759 44.40% 55.50% 0.14% 0.00% NA
All Japonica  1512 96.10% 3.90% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 16.00% 83.50% 0.50% 0.00% NA
Indica II  465 60.20% 39.80% 0.00% 0.00% NA
Indica III  913 48.70% 51.30% 0.00% 0.00% NA
Indica Intermediate  786 51.50% 48.30% 0.13% 0.00% NA
Temperate Japonica  767 93.60% 6.40% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211077849 C -> T LOC_Os12g19040.1 upstream_gene_variant ; 4364.0bp to feature; MODIFIER silent_mutation Average:37.49; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1211077849 C -> T LOC_Os12g19080.1 downstream_gene_variant ; 1546.0bp to feature; MODIFIER silent_mutation Average:37.49; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1211077849 C -> T LOC_Os12g19090.1 downstream_gene_variant ; 3275.0bp to feature; MODIFIER silent_mutation Average:37.49; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1211077849 C -> T LOC_Os12g19040-LOC_Os12g19080 intergenic_region ; MODIFIER silent_mutation Average:37.49; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211077849 NA 5.91E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 8.30E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 1.15E-10 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 7.83E-08 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 3.79E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 3.98E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 8.72E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 3.80E-09 mr1361_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 4.00E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 7.27E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 1.96E-06 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 2.42E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 2.42E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211077849 NA 4.73E-08 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251