\
| Variant ID: vg1211062870 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 11062870 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
GTGTTTCAATACTGTATTAATCGTAGCACATATCGTTACTTTATCAGCTAGTATGTACGATAAGAACTTAACACCAGAAGGTCTAAGATGACCGATATAT[G/A]
TAGTGTAAAACTAACTTTCAAGGTGAGTATAATGTAAAATTGTAAGTGCTCCATATAACAAGAATATGAAGGACCTGTGCAACAAAATAAATCACATTTA
TAAATGTGATTTATTTTGTTGCACAGGTCCTTCATATTCTTGTTATATGGAGCACTTACAATTTTACATTATACTCACCTTGAAAGTTAGTTTTACACTA[C/T]
ATATATCGGTCATCTTAGACCTTCTGGTGTTAAGTTCTTATCGTACATACTAGCTGATAAAGTAACGATATGTGCTACGATTAATACAGTATTGAAACAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.40% | 6.70% | 1.95% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 74.60% | 20.20% | 5.22% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 0.20% | 1.29% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.10% | 1.40% | 4.43% | 0.00% | NA |
| Tropical Japonica | 504 | 37.30% | 55.40% | 7.34% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 6.20% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 6.70% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211062870 | G -> A | LOC_Os12g19040.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.659; most accessible tissue: Callus, score: 64.495 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211062870 | NA | 5.22E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 4.08E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 4.06E-09 | mr1364 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 6.31E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 8.99E-09 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 8.49E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 7.12E-06 | mr1653 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 4.73E-08 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 3.95E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 4.32E-10 | mr1364_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 1.67E-06 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211062870 | NA | 2.08E-06 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |