Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1210993634:

Variant ID: vg1210993634 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10993634
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTCTTCTCTTTACTACGCTCAGGCTAATGGATAAGCCGAGTCGAGTAATAAAACATTGTTGAAATTGTCGTTTTGCCAGTTGAGATAAATCTTGGCT[C/T]
TCTTCGGTATTTCAAGCAAGACGACTTGTCGGTTGAAGATTACAAGACCTTGATGGGAAGCAATTTTTGAAGATGTCATCGACGAGCATTTGAAGACTTT

Reverse complement sequence

AAAGTCTTCAAATGCTCGTCGATGACATCTTCAAAAATTGCTTCCCATCAAGGTCTTGTAATCTTCAACCGACAAGTCGTCTTGCTTGAAATACCGAAGA[G/A]
AGCCAAGATTTATCTCAACTGGCAAAACGACAATTTCAACAATGTTTTATTACTCGACTCGGCTTATCCATTAGCCTGAGCGTAGTAAAGAGAAGAACTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 16.30% 0.04% 0.00% NA
All Indica  2759 87.40% 12.60% 0.04% 0.00% NA
All Japonica  1512 73.90% 26.10% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 88.90% 10.90% 0.17% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 83.20% 16.80% 0.00% 0.00% NA
Indica Intermediate  786 85.80% 14.20% 0.00% 0.00% NA
Temperate Japonica  767 72.90% 27.10% 0.00% 0.00% NA
Tropical Japonica  504 83.90% 16.10% 0.00% 0.00% NA
Japonica Intermediate  241 56.40% 43.60% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210993634 C -> T LOC_Os12g18930.1 downstream_gene_variant ; 2683.0bp to feature; MODIFIER silent_mutation Average:38.066; most accessible tissue: Zhenshan97 flower, score: 88.302 N N N N
vg1210993634 C -> T LOC_Os12g18940.1 downstream_gene_variant ; 2179.0bp to feature; MODIFIER silent_mutation Average:38.066; most accessible tissue: Zhenshan97 flower, score: 88.302 N N N N
vg1210993634 C -> T LOC_Os12g18950.1 downstream_gene_variant ; 839.0bp to feature; MODIFIER silent_mutation Average:38.066; most accessible tissue: Zhenshan97 flower, score: 88.302 N N N N
vg1210993634 C -> T LOC_Os12g18940-LOC_Os12g18950 intergenic_region ; MODIFIER silent_mutation Average:38.066; most accessible tissue: Zhenshan97 flower, score: 88.302 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1210993634 C T -0.01 -0.02 -0.02 -0.02 -0.01 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210993634 NA 2.06E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 1.75E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 6.03E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 4.89E-08 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 4.22E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 1.66E-06 mr1293 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 4.77E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 9.41E-06 mr1507 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 4.79E-06 4.17E-10 mr1729 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 9.25E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 8.08E-06 mr1809 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 2.71E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 2.32E-06 mr1906 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 8.38E-07 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 1.70E-06 mr1960 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 2.43E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 4.70E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 6.09E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 3.15E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 2.51E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 6.55E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 6.52E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 1.12E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 6.39E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 5.33E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 9.98E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 2.81E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 7.04E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 7.70E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 7.25E-07 mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 7.94E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 4.80E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 5.03E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210993634 NA 2.04E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251