\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210833632:

Variant ID: vg1210833632 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10833632
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.03, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTCATTCTATTATTTCCTATATTTATATGGATATTAATGAATCTATATATATATATATATATATTTGTCTAGATTTATTAACATCAATATGAATGTGG[A/G]
AAATACTGAATGACTTACATTTTGAAACGGAGGGAGTAATGCAAACCGAGGATGAAAAAATATATATGCCTATACGGTACTGCTCCATTTCCAAATAAAT

Reverse complement sequence

ATTTATTTGGAAATGGAGCAGTACCGTATAGGCATATATATTTTTTCATCCTCGGTTTGCATTACTCCCTCCGTTTCAAAATGTAAGTCATTCAGTATTT[T/C]
CCACATTCATATTGATGTTAATAAATCTAGACAAATATATATATATATATATATAGATTCATTAATATCCATATAAATATAGGAAATAATAGAATGACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 36.00% 2.48% 22.26% NA
All Indica  2759 21.40% 48.30% 3.81% 26.46% NA
All Japonica  1512 69.40% 20.10% 0.33% 10.19% NA
Aus  269 54.30% 4.50% 0.37% 40.89% NA
Indica I  595 46.70% 45.40% 3.19% 4.71% NA
Indica II  465 23.00% 36.10% 1.51% 39.35% NA
Indica III  913 5.90% 56.60% 5.26% 32.20% NA
Indica Intermediate  786 19.30% 48.10% 3.94% 28.63% NA
Temperate Japonica  767 73.70% 9.40% 0.65% 16.30% NA
Tropical Japonica  504 69.60% 30.20% 0.00% 0.20% NA
Japonica Intermediate  241 55.20% 33.20% 0.00% 11.62% NA
VI/Aromatic  96 28.10% 21.90% 2.08% 47.92% NA
Intermediate  90 48.90% 33.30% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210833632 A -> DEL N N silent_mutation Average:89.857; most accessible tissue: Zhenshan97 young leaf, score: 96.355 N N N N
vg1210833632 A -> G LOC_Os12g18729.1 3_prime_UTR_variant ; 138.0bp to feature; MODIFIER silent_mutation Average:89.857; most accessible tissue: Zhenshan97 young leaf, score: 96.355 N N N N
vg1210833632 A -> G LOC_Os12g18729.2 3_prime_UTR_variant ; 138.0bp to feature; MODIFIER silent_mutation Average:89.857; most accessible tissue: Zhenshan97 young leaf, score: 96.355 N N N N
vg1210833632 A -> G LOC_Os12g18729.3 3_prime_UTR_variant ; 138.0bp to feature; MODIFIER silent_mutation Average:89.857; most accessible tissue: Zhenshan97 young leaf, score: 96.355 N N N N
vg1210833632 A -> G LOC_Os12g18729.4 3_prime_UTR_variant ; 138.0bp to feature; MODIFIER silent_mutation Average:89.857; most accessible tissue: Zhenshan97 young leaf, score: 96.355 N N N N
vg1210833632 A -> G LOC_Os12g18729.5 3_prime_UTR_variant ; 138.0bp to feature; MODIFIER silent_mutation Average:89.857; most accessible tissue: Zhenshan97 young leaf, score: 96.355 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1210833632 A G -0.08 -0.08 -0.03 -0.01 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210833632 NA 2.71E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1210833632 NA 4.38E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 1.16E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 8.69E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 2.37E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 7.43E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 1.20E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 3.66E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 7.04E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 2.50E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 3.54E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 2.26E-08 mr1959 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 9.15E-12 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 5.01E-10 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 4.79E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 7.20E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 2.55E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 1.23E-06 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 2.97E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 4.33E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 4.14E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 2.15E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 4.82E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 1.13E-08 mr1682_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 4.70E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 3.30E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 4.99E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 2.19E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 9.46E-06 1.58E-09 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 1.53E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 4.37E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210833632 NA 5.15E-06 mr1972_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251