Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210709667:

Variant ID: vg1210709667 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10709667
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CAGAAAGCCAATTATGGAATGTAATAATAGTGTAGCATATTACTCGAATTTCCCTTGGCACATTACTTTCCAAATATTAAGTCGAAGGAAGGAATATATA[C/A]
GACTGGGTATATATTAGGTACGTGGACGTACGTACGTTTTTATACGGGGAAAATATCGATCATACTAGCTACGCTAGCTGCAGCATCAATCGATCTATCC

Reverse complement sequence

GGATAGATCGATTGATGCTGCAGCTAGCGTAGCTAGTATGATCGATATTTTCCCCGTATAAAAACGTACGTACGTCCACGTACCTAATATATACCCAGTC[G/T]
TATATATTCCTTCCTTCGACTTAATATTTGGAAAGTAATGTGCCAAGGGAAATTCGAGTAATATGCTACACTATTATTACATTCCATAATTGGCTTTCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 14.10% 10.54% 9.10% NA
All Indica  2759 59.00% 9.40% 17.07% 14.46% NA
All Japonica  1512 78.50% 19.10% 1.12% 1.26% NA
Aus  269 62.50% 36.80% 0.00% 0.74% NA
Indica I  595 64.70% 10.40% 18.82% 6.05% NA
Indica II  465 68.20% 1.30% 17.85% 12.69% NA
Indica III  913 49.80% 12.30% 15.01% 22.89% NA
Indica Intermediate  786 60.10% 10.20% 17.68% 12.09% NA
Temperate Japonica  767 91.80% 3.90% 1.96% 2.35% NA
Tropical Japonica  504 64.30% 35.10% 0.40% 0.20% NA
Japonica Intermediate  241 66.00% 34.00% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 5.20% 5.21% 7.29% NA
Intermediate  90 75.60% 15.60% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210709667 C -> DEL N N silent_mutation Average:73.274; most accessible tissue: Zhenshan97 young leaf, score: 87.299 N N N N
vg1210709667 C -> A LOC_Os12g18520.1 upstream_gene_variant ; 297.0bp to feature; MODIFIER silent_mutation Average:73.274; most accessible tissue: Zhenshan97 young leaf, score: 87.299 N N N N
vg1210709667 C -> A LOC_Os12g18530.1 downstream_gene_variant ; 2214.0bp to feature; MODIFIER silent_mutation Average:73.274; most accessible tissue: Zhenshan97 young leaf, score: 87.299 N N N N
vg1210709667 C -> A LOC_Os12g18510-LOC_Os12g18520 intergenic_region ; MODIFIER silent_mutation Average:73.274; most accessible tissue: Zhenshan97 young leaf, score: 87.299 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210709667 NA 2.91E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 3.60E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 6.34E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.59E-07 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 7.08E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 4.46E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.23E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 5.01E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.40E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 2.96E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 3.17E-07 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 8.19E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.42E-07 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 8.14E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 8.11E-06 8.10E-06 mr1372_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 7.07E-06 7.06E-06 mr1372_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 4.21E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 7.17E-07 4.64E-09 mr1545_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.01E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.73E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 2.20E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 2.58E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.32E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 4.39E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.56E-06 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 5.99E-07 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 9.23E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 3.07E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 2.11E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.41E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 3.42E-06 mr1740_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 7.37E-06 mr1741_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 3.85E-06 mr1751_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 5.50E-07 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 1.49E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 6.16E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210709667 NA 6.15E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251