\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210259194:

Variant ID: vg1210259194 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10259194
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCCCGCCGCTCCGGCCACCGCCGCCGCTCCCTCCCTCGGCTCTCTGGCTCCGGCCACCACTGCCGCCCCATCCCTTCGCTCTCTAGCTCCAGCCACCG[G/A]
CGCCCCGGCTCCGACCACCACCGCCGCCCCCTTCCCTCGCTCTCTAGCTCCGGCCACCGCCACCGCTCTCCCCCTGTCACGCTCGGAAATTCACTAGCAA

Reverse complement sequence

TTGCTAGTGAATTTCCGAGCGTGACAGGGGGAGAGCGGTGGCGGTGGCCGGAGCTAGAGAGCGAGGGAAGGGGGCGGCGGTGGTGGTCGGAGCCGGGGCG[C/T]
CGGTGGCTGGAGCTAGAGAGCGAAGGGATGGGGCGGCAGTGGTGGCCGGAGCCAGAGAGCCGAGGGAGGGAGCGGCGGCGGTGGCCGGAGCGGCGGGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 24.70% 1.12% 0.00% NA
All Indica  2759 72.70% 26.00% 1.34% 0.00% NA
All Japonica  1512 80.80% 19.20% 0.00% 0.00% NA
Aus  269 52.00% 42.80% 5.20% 0.00% NA
Indica I  595 89.90% 10.10% 0.00% 0.00% NA
Indica II  465 65.80% 33.80% 0.43% 0.00% NA
Indica III  913 67.30% 30.10% 2.63% 0.00% NA
Indica Intermediate  786 70.10% 28.50% 1.40% 0.00% NA
Temperate Japonica  767 95.30% 4.70% 0.00% 0.00% NA
Tropical Japonica  504 65.70% 34.30% 0.00% 0.00% NA
Japonica Intermediate  241 66.40% 33.60% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 20.80% 1.04% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210259194 G -> A LOC_Os12g17880.1 upstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:72.957; most accessible tissue: Minghui63 young leaf, score: 89.337 N N N N
vg1210259194 G -> A LOC_Os12g17890.1 upstream_gene_variant ; 230.0bp to feature; MODIFIER silent_mutation Average:72.957; most accessible tissue: Minghui63 young leaf, score: 89.337 N N N N
vg1210259194 G -> A LOC_Os12g17890-LOC_Os12g17900 intergenic_region ; MODIFIER silent_mutation Average:72.957; most accessible tissue: Minghui63 young leaf, score: 89.337 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1210259194 G A -0.02 -0.02 -0.02 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210259194 NA 1.44E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210259194 NA 7.81E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210259194 NA 1.75E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210259194 2.70E-06 2.70E-06 mr1663 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210259194 1.48E-06 6.11E-10 mr1425_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210259194 NA 1.89E-08 mr1425_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210259194 NA 4.84E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251