Variant ID: vg1210106416 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 10106416 |
Reference Allele: G | Alternative Allele: T,A |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTATGTCTAATTCCTCGTATATTTATTTTTCTATGATATACGTAAGAGTAAATTGGACAATTCATTATAGATTTTGCATGAATGATGACATGGCATATTC[G/T,A]
TATGATGATTTTGGTGGACCCAAGGACTATTCTATGCCTTATGACAAAGTTTAAGGATTTCTTTAGACCATTTAAAAGGTTAGGGACTAAACTGATATAC
GTATATCAGTTTAGTCCCTAACCTTTTAAATGGTCTAAAGAAATCCTTAAACTTTGTCATAAGGCATAGAATAGTCCTTGGGTCCACCAAAATCATCATA[C/A,T]
GAATATGCCATGTCATCATTCATGCAAAATCTATAATGAATTGTCCAATTTACTCTTACGTATATCATAGAAAAATAAATATACGAGGAATTAGACATAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.80% | 2.70% | 0.42% | 0.00% | A: 0.06% |
All Indica | 2759 | 99.60% | 0.10% | 0.11% | 0.00% | A: 0.11% |
All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
Aus | 269 | 68.80% | 27.10% | 4.09% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.60% | 0.10% | 0.22% | 0.00% | A: 0.11% |
Indica Intermediate | 786 | 99.40% | 0.30% | 0.13% | 0.00% | A: 0.25% |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 53.10% | 43.80% | 3.12% | 0.00% | NA |
Intermediate | 90 | 88.90% | 8.90% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1210106416 | G -> A | LOC_Os12g17640.1 | upstream_gene_variant ; 820.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
vg1210106416 | G -> A | LOC_Os12g17650.1 | upstream_gene_variant ; 640.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
vg1210106416 | G -> A | LOC_Os12g17640-LOC_Os12g17650 | intergenic_region ; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
vg1210106416 | G -> T | LOC_Os12g17640.1 | upstream_gene_variant ; 820.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
vg1210106416 | G -> T | LOC_Os12g17650.1 | upstream_gene_variant ; 640.0bp to feature; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
vg1210106416 | G -> T | LOC_Os12g17640-LOC_Os12g17650 | intergenic_region ; MODIFIER | silent_mutation | Average:43.402; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1210106416 | 1.02E-06 | 8.32E-16 | mr1585 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210106416 | NA | 1.88E-11 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |