| Variant ID: vg1209941601 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9941601 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCCATTGGCGTTCGAGAGATAATCGAGAACTAGTAAATTGTAGCAATCTCTCGCGCCTTAATTTCAGATGGTCGAGGTACGACTACGGCAATAGCGTAG[C/A]
GGTCCTCGCACCACGACTTCAGATGGTTGAGGTACGACTACGACTGGTCTTCAACCAACAGCGTAGTGGTCCTCGCACCACGACTTCAATCGGTCGAGAG
CTCTCGACCGATTGAAGTCGTGGTGCGAGGACCACTACGCTGTTGGTTGAAGACCAGTCGTAGTCGTACCTCAACCATCTGAAGTCGTGGTGCGAGGACC[G/T]
CTACGCTATTGCCGTAGTCGTACCTCGACCATCTGAAATTAAGGCGCGAGAGATTGCTACAATTTACTAGTTCTCGATTATCTCTCGAACGCCAATGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.00% | 0.80% | 26.98% | 23.28% | NA |
| All Indica | 2759 | 38.50% | 1.30% | 43.46% | 16.82% | NA |
| All Japonica | 1512 | 77.10% | 0.00% | 2.71% | 20.24% | NA |
| Aus | 269 | 6.30% | 0.00% | 5.58% | 88.10% | NA |
| Indica I | 595 | 34.10% | 0.80% | 34.29% | 30.76% | NA |
| Indica II | 465 | 38.30% | 1.50% | 47.96% | 12.26% | NA |
| Indica III | 913 | 40.90% | 1.10% | 48.19% | 9.86% | NA |
| Indica Intermediate | 786 | 39.10% | 1.70% | 42.24% | 17.05% | NA |
| Temperate Japonica | 767 | 85.70% | 0.00% | 4.04% | 10.30% | NA |
| Tropical Japonica | 504 | 68.50% | 0.00% | 1.59% | 29.96% | NA |
| Japonica Intermediate | 241 | 67.60% | 0.00% | 0.83% | 31.54% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 8.33% | 70.83% | NA |
| Intermediate | 90 | 57.80% | 1.10% | 13.33% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209941601 | C -> DEL | LOC_Os12g17360.1 | N | frameshift_variant | Average:38.841; most accessible tissue: Minghui63 young leaf, score: 74.007 | N | N | N | N |
| vg1209941601 | C -> A | LOC_Os12g17360.1 | missense_variant ; p.Ala24Glu; MODERATE | nonsynonymous_codon ; A24E | Average:38.841; most accessible tissue: Minghui63 young leaf, score: 74.007 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209941601 | NA | 1.93E-07 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209941601 | 1.51E-06 | 2.50E-09 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209941601 | NA | 1.61E-07 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209941601 | 1.26E-10 | 1.42E-16 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209941601 | 6.81E-09 | 2.14E-14 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209941601 | 7.80E-06 | 1.63E-21 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209941601 | NA | 1.03E-15 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209941601 | 4.07E-06 | 4.06E-06 | mr1983_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209941601 | 1.07E-06 | 1.07E-06 | mr1983_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |