Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209941601:

Variant ID: vg1209941601 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9941601
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCATTGGCGTTCGAGAGATAATCGAGAACTAGTAAATTGTAGCAATCTCTCGCGCCTTAATTTCAGATGGTCGAGGTACGACTACGGCAATAGCGTAG[C/A]
GGTCCTCGCACCACGACTTCAGATGGTTGAGGTACGACTACGACTGGTCTTCAACCAACAGCGTAGTGGTCCTCGCACCACGACTTCAATCGGTCGAGAG

Reverse complement sequence

CTCTCGACCGATTGAAGTCGTGGTGCGAGGACCACTACGCTGTTGGTTGAAGACCAGTCGTAGTCGTACCTCAACCATCTGAAGTCGTGGTGCGAGGACC[G/T]
CTACGCTATTGCCGTAGTCGTACCTCGACCATCTGAAATTAAGGCGCGAGAGATTGCTACAATTTACTAGTTCTCGATTATCTCTCGAACGCCAATGGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.00%	0.80%	26.98%	23.28%	NA
All Indica	2759	38.50%	1.30%	43.46%	16.82%	NA
All Japonica	1512	77.10%	0.00%	2.71%	20.24%	NA
Aus	269	6.30%	0.00%	5.58%	88.10%	NA
Indica I	595	34.10%	0.80%	34.29%	30.76%	NA
Indica II	465	38.30%	1.50%	47.96%	12.26%	NA
Indica III	913	40.90%	1.10%	48.19%	9.86%	NA
Indica Intermediate	786	39.10%	1.70%	42.24%	17.05%	NA
Temperate Japonica	767	85.70%	0.00%	4.04%	10.30%	NA
Tropical Japonica	504	68.50%	0.00%	1.59%	29.96%	NA
Japonica Intermediate	241	67.60%	0.00%	0.83%	31.54%	NA
VI/Aromatic	96	20.80%	0.00%	8.33%	70.83%	NA
Intermediate	90	57.80%	1.10%	13.33%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209941601	C -> DEL	LOC_Os12g17360.1	N	frameshift_variant	Average:38.841; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1209941601	C -> A	LOC_Os12g17360.1	missense_variant ; p.Ala24Glu; MODERATE	nonsynonymous_codon ; A24E	Average:38.841; most accessible tissue: Minghui63 young leaf, score: 74.007	unknown	unknown	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209941601	NA	1.93E-07	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209941601	1.51E-06	2.50E-09	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209941601	NA	1.61E-07	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209941601	1.26E-10	1.42E-16	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209941601	6.81E-09	2.14E-14	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209941601	7.80E-06	1.63E-21	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209941601	NA	1.03E-15	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209941601	4.07E-06	4.06E-06	mr1983_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209941601	1.07E-06	1.07E-06	mr1983_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251