\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209926499:

Variant ID: vg1209926499 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9926499
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCATTCCTTCTAGGGTTCCACCATATATATACCTCTTGTAAGCCGCCGTGCGGCGTTGTAACCTCACCCCAGATATAGTGAAGATATTTTGCTGGCT[A/G]
GTGCCCGTGGTTTTTTCTCTTCTGTTTTGGGAGGGTTTTCCACGCTAAAATCTCGTGTCTTCTGTGATTGATCTATTGTTTTTTATCGTTTGTTTGCCTA

Reverse complement sequence

TAGGCAAACAAACGATAAAAAACAATAGATCAATCACAGAAGACACGAGATTTTAGCGTGGAAAACCCTCCCAAAACAGAAGAGAAAAAACCACGGGCAC[T/C]
AGCCAGCAAAATATCTTCACTATATCTGGGGTGAGGTTACAACGCCGCACGGCGGCTTACAAGAGGTATATATATGGTGGAACCCTAGAAGGAATGACGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 44.60% 0.38% 6.98% NA
All Indica  2759 27.00% 61.10% 0.54% 11.38% NA
All Japonica  1512 79.60% 20.20% 0.13% 0.13% NA
Aus  269 74.30% 21.60% 0.00% 4.09% NA
Indica I  595 24.70% 74.30% 0.50% 0.50% NA
Indica II  465 31.00% 40.60% 0.43% 27.96% NA
Indica III  913 27.90% 63.70% 0.11% 8.21% NA
Indica Intermediate  786 25.20% 60.20% 1.15% 13.49% NA
Temperate Japonica  767 85.30% 14.30% 0.26% 0.13% NA
Tropical Japonica  504 69.60% 30.40% 0.00% 0.00% NA
Japonica Intermediate  241 82.20% 17.40% 0.00% 0.41% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 60.00% 35.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209926499 A -> DEL N N silent_mutation Average:74.63; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1209926499 A -> G LOC_Os12g17320.1 upstream_gene_variant ; 3839.0bp to feature; MODIFIER silent_mutation Average:74.63; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1209926499 A -> G LOC_Os12g17330.1 upstream_gene_variant ; 268.0bp to feature; MODIFIER silent_mutation Average:74.63; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1209926499 A -> G LOC_Os12g17340.1 downstream_gene_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:74.63; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1209926499 A -> G LOC_Os12g17330-LOC_Os12g17340 intergenic_region ; MODIFIER silent_mutation Average:74.63; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209926499 A G 0.02 0.01 0.01 0.03 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209926499 3.44E-08 1.82E-21 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 9.38E-06 5.73E-17 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 5.11E-06 4.79E-08 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 6.01E-06 1.55E-17 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 9.80E-12 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 2.13E-07 3.31E-19 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 1.56E-06 9.36E-19 mr1079 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 8.97E-06 6.02E-15 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 1.03E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 4.22E-08 1.19E-19 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 3.63E-06 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 2.74E-06 1.37E-17 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 1.62E-09 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 1.24E-06 1.62E-17 mr1490 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 3.45E-14 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 1.08E-06 1.06E-11 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 8.56E-16 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 3.16E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 1.43E-17 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 8.06E-16 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 1.17E-13 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 8.85E-18 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 4.44E-06 5.88E-18 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 4.95E-10 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 2.64E-15 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 8.85E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209926499 NA 8.09E-09 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251