Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209813012:

Variant ID: vg1209813012 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9813012
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCTGTCATCAACTCGGCGGGCCTAGAGCTCTCGCCGACAAAGTTATAGGCTAGATTAGCGTTGTGACCTCTACTCGTGAGAATCAAATAGAATGTATAG[G/C]
GTTATTGGACTGAATCAATTTAAAAATCCCATTATTTTTCTTTCTGTCAGCACCCTTACACCTGCCATACGCTATATACATAAATACATATGAAATCAAT

Reverse complement sequence

ATTGATTTCATATGTATTTATGTATATAGCGTATGGCAGGTGTAAGGGTGCTGACAGAAAGAAAAATAATGGGATTTTTAAATTGATTCAGTCCAATAAC[C/G]
CTATACATTCTATTTGATTCTCACGAGTAGAGGTCACAACGCTAATCTAGCCTATAACTTTGTCGGCGAGAGCTCTAGGCCCGCCGAGTTGATGACAGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.70%	3.50%	0.42%	0.34%	NA
All Indica	2759	99.30%	0.10%	0.11%	0.40%	NA
All Japonica	1512	88.80%	10.40%	0.86%	0.00%	NA
Aus	269	98.10%	0.00%	0.00%	1.86%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.50%	0.00%	0.11%	0.44%	NA
Indica Intermediate	786	98.60%	0.30%	0.25%	0.89%	NA
Temperate Japonica	767	98.70%	0.40%	0.91%	0.00%	NA
Tropical Japonica	504	69.40%	29.60%	0.99%	0.00%	NA
Japonica Intermediate	241	97.50%	2.10%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	4.40%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209813012	G -> C	LOC_Os12g17140.1	upstream_gene_variant ; 542.0bp to feature; MODIFIER	silent_mutation	Average:65.423; most accessible tissue: Callus, score: 83.262	N	N	N	N
vg1209813012	G -> C	LOC_Os12g17150.1	upstream_gene_variant ; 2668.0bp to feature; MODIFIER	silent_mutation	Average:65.423; most accessible tissue: Callus, score: 83.262	N	N	N	N
vg1209813012	G -> C	LOC_Os12g17140-LOC_Os12g17150	intergenic_region ; MODIFIER	silent_mutation	Average:65.423; most accessible tissue: Callus, score: 83.262	N	N	N	N
vg1209813012	G -> DEL	N	N	silent_mutation	Average:65.423; most accessible tissue: Callus, score: 83.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209813012	NA	8.15E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012	6.54E-06	1.73E-08	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012	7.52E-06	3.79E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012	9.13E-07	3.32E-09	mr1583_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012	NA	1.77E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012	6.11E-08	3.16E-12	mr1850_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251