\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209813012:

Variant ID: vg1209813012 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9813012
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTGTCATCAACTCGGCGGGCCTAGAGCTCTCGCCGACAAAGTTATAGGCTAGATTAGCGTTGTGACCTCTACTCGTGAGAATCAAATAGAATGTATAG[G/C]
GTTATTGGACTGAATCAATTTAAAAATCCCATTATTTTTCTTTCTGTCAGCACCCTTACACCTGCCATACGCTATATACATAAATACATATGAAATCAAT

Reverse complement sequence

ATTGATTTCATATGTATTTATGTATATAGCGTATGGCAGGTGTAAGGGTGCTGACAGAAAGAAAAATAATGGGATTTTTAAATTGATTCAGTCCAATAAC[C/G]
CTATACATTCTATTTGATTCTCACGAGTAGAGGTCACAACGCTAATCTAGCCTATAACTTTGTCGGCGAGAGCTCTAGGCCCGCCGAGTTGATGACAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 3.50% 0.42% 0.34% NA
All Indica  2759 99.30% 0.10% 0.11% 0.40% NA
All Japonica  1512 88.80% 10.40% 0.86% 0.00% NA
Aus  269 98.10% 0.00% 0.00% 1.86% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.50% 0.00% 0.11% 0.44% NA
Indica Intermediate  786 98.60% 0.30% 0.25% 0.89% NA
Temperate Japonica  767 98.70% 0.40% 0.91% 0.00% NA
Tropical Japonica  504 69.40% 29.60% 0.99% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 4.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209813012 G -> C LOC_Os12g17140.1 upstream_gene_variant ; 542.0bp to feature; MODIFIER silent_mutation Average:65.423; most accessible tissue: Callus, score: 83.262 N N N N
vg1209813012 G -> C LOC_Os12g17150.1 upstream_gene_variant ; 2668.0bp to feature; MODIFIER silent_mutation Average:65.423; most accessible tissue: Callus, score: 83.262 N N N N
vg1209813012 G -> C LOC_Os12g17140-LOC_Os12g17150 intergenic_region ; MODIFIER silent_mutation Average:65.423; most accessible tissue: Callus, score: 83.262 N N N N
vg1209813012 G -> DEL N N silent_mutation Average:65.423; most accessible tissue: Callus, score: 83.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209813012 NA 8.15E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012 6.54E-06 1.73E-08 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012 7.52E-06 3.79E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012 9.13E-07 3.32E-09 mr1583_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012 NA 1.77E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813012 6.11E-08 3.16E-12 mr1850_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251