| Variant ID: vg1209813012 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9813012 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTCTGTCATCAACTCGGCGGGCCTAGAGCTCTCGCCGACAAAGTTATAGGCTAGATTAGCGTTGTGACCTCTACTCGTGAGAATCAAATAGAATGTATAG[G/C]
GTTATTGGACTGAATCAATTTAAAAATCCCATTATTTTTCTTTCTGTCAGCACCCTTACACCTGCCATACGCTATATACATAAATACATATGAAATCAAT
ATTGATTTCATATGTATTTATGTATATAGCGTATGGCAGGTGTAAGGGTGCTGACAGAAAGAAAAATAATGGGATTTTTAAATTGATTCAGTCCAATAAC[C/G]
CTATACATTCTATTTGATTCTCACGAGTAGAGGTCACAACGCTAATCTAGCCTATAACTTTGTCGGCGAGAGCTCTAGGCCCGCCGAGTTGATGACAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 3.50% | 0.42% | 0.34% | NA |
| All Indica | 2759 | 99.30% | 0.10% | 0.11% | 0.40% | NA |
| All Japonica | 1512 | 88.80% | 10.40% | 0.86% | 0.00% | NA |
| Aus | 269 | 98.10% | 0.00% | 0.00% | 1.86% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.00% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 98.60% | 0.30% | 0.25% | 0.89% | NA |
| Temperate Japonica | 767 | 98.70% | 0.40% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 69.40% | 29.60% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 4.40% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209813012 | G -> C | LOC_Os12g17140.1 | upstream_gene_variant ; 542.0bp to feature; MODIFIER | silent_mutation | Average:65.423; most accessible tissue: Callus, score: 83.262 | N | N | N | N |
| vg1209813012 | G -> C | LOC_Os12g17150.1 | upstream_gene_variant ; 2668.0bp to feature; MODIFIER | silent_mutation | Average:65.423; most accessible tissue: Callus, score: 83.262 | N | N | N | N |
| vg1209813012 | G -> C | LOC_Os12g17140-LOC_Os12g17150 | intergenic_region ; MODIFIER | silent_mutation | Average:65.423; most accessible tissue: Callus, score: 83.262 | N | N | N | N |
| vg1209813012 | G -> DEL | N | N | silent_mutation | Average:65.423; most accessible tissue: Callus, score: 83.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209813012 | NA | 8.15E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209813012 | 6.54E-06 | 1.73E-08 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209813012 | 7.52E-06 | 3.79E-08 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209813012 | 9.13E-07 | 3.32E-09 | mr1583_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209813012 | NA | 1.77E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209813012 | 6.11E-08 | 3.16E-12 | mr1850_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |