Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209746327:

Variant ID: vg1209746327 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9746327
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCTCGGTAGCCACGTGGTTTCCACGTGTGCAGCCCGCGTGGTGTCTAGTGGAGTCCGTTTGTCGGCCACTCGCCTCGGTTGACACACGGGGTCCGCTTC[T/C]
GTCGACCCGTGGACCGTCTCTATGTACCCGGTCTGCCGTGGTCTCTTAGGTTGACATGTGGGGTCCGCATGTCAACAGCGCAGCCTTCCTGTCTTTTCCA

Reverse complement sequence

TGGAAAAGACAGGAAGGCTGCGCTGTTGACATGCGGACCCCACATGTCAACCTAAGAGACCACGGCAGACCGGGTACATAGAGACGGTCCACGGGTCGAC[A/G]
GAAGCGGACCCCGTGTGTCAACCGAGGCGAGTGGCCGACAAACGGACTCCACTAGACACCACGCGGGCTGCACACGTGGAAACCACGTGGCTACCGAGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	0.70%	7.89%	16.36%	NA
All Indica	2759	78.00%	1.20%	11.09%	9.79%	NA
All Japonica	1512	82.00%	0.10%	1.92%	16.01%	NA
Aus	269	15.60%	0.00%	8.92%	75.46%	NA
Indica I	595	70.90%	2.20%	12.27%	14.62%	NA
Indica II	465	72.00%	0.90%	14.62%	12.47%	NA
Indica III	913	85.10%	0.40%	9.64%	4.82%	NA
Indica Intermediate	786	78.50%	1.40%	9.80%	10.31%	NA
Temperate Japonica	767	90.00%	0.00%	0.65%	9.39%	NA
Tropical Japonica	504	79.80%	0.00%	1.98%	18.25%	NA
Japonica Intermediate	241	61.40%	0.40%	5.81%	32.37%	NA
VI/Aromatic	96	45.80%	0.00%	8.33%	45.83%	NA
Intermediate	90	77.80%	0.00%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209746327	T -> C	LOC_Os12g17040.1	upstream_gene_variant ; 3371.0bp to feature; MODIFIER	silent_mutation	Average:48.303; most accessible tissue: Minghui63 flag leaf, score: 88.459	N	N	N	N
vg1209746327	T -> C	LOC_Os12g17030-LOC_Os12g17040	intergenic_region ; MODIFIER	silent_mutation	Average:48.303; most accessible tissue: Minghui63 flag leaf, score: 88.459	N	N	N	N
vg1209746327	T -> DEL	N	N	silent_mutation	Average:48.303; most accessible tissue: Minghui63 flag leaf, score: 88.459	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1209746327	T	C	0.0	0.0	0.0	-0.01	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209746327	NA	2.74E-06	mr1826_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251