\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209691208:

Variant ID: vg1209691208 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9691208
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, G: 0.14, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


CGAACGGGCTGCAAAAGAGGCTGAGGACTGGCGACAACGTGCCCTGGATGCCGGGCGACAAGCATAGGAACTTATTGGGCAACAAGACGTCGAGGGGACA[G/A]
CGGTTTTCCGCCCCCCCAACAGAACGCGGTTGCAGCGATCACCCTCCTCGACATCCTCCTCAAGGAAGACGCGCTCAATCAAGCCAATCACGTCGTCAAC

Reverse complement sequence

GTTGACGACGTGATTGGCTTGATTGAGCGCGTCTTCCTTGAGGAGGATGTCGAGGAGGGTGATCGCTGCAACCGCGTTCTGTTGGGGGGGCGGAAAACCG[C/T]
TGTCCCCTCGACGTCTTGTTGCCCAATAAGTTCCTATGCTTGTCGCCCGGCATCCAGGGCACGTTGTCGCCAGTCCTCAGCCTCTTTTGCAGCCCGTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 33.60% 1.16% 24.04% NA
All Indica  2759 25.40% 35.80% 1.63% 37.15% NA
All Japonica  1512 77.20% 19.60% 0.13% 3.04% NA
Aus  269 7.10% 77.70% 0.37% 14.87% NA
Indica I  595 39.00% 45.20% 1.34% 14.45% NA
Indica II  465 31.80% 38.10% 1.51% 28.60% NA
Indica III  913 11.20% 25.60% 1.64% 61.56% NA
Indica Intermediate  786 27.90% 39.20% 1.91% 31.04% NA
Temperate Japonica  767 85.40% 9.30% 0.13% 5.22% NA
Tropical Japonica  504 74.00% 24.80% 0.20% 0.99% NA
Japonica Intermediate  241 58.10% 41.50% 0.00% 0.41% NA
VI/Aromatic  96 10.40% 64.60% 6.25% 18.75% NA
Intermediate  90 55.60% 35.60% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209691208 G -> DEL LOC_Os12g16900.1 N frameshift_variant Average:54.672; most accessible tissue: Minghui63 flag leaf, score: 74.955 N N N N
vg1209691208 G -> A LOC_Os12g16900.1 splice_region_variant&synonymous_variant ; p.Gln177Gln; LOW stop_gained Average:54.672; most accessible tissue: Minghui63 flag leaf, score: 74.955 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209691208 NA 2.37E-14 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 3.47E-13 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 2.42E-28 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 1.18E-15 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 5.32E-13 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 1.26E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 2.75E-15 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 1.87E-16 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 5.52E-12 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 1.47E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 3.29E-14 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 9.13E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 2.61E-06 NA mr1364 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 1.38E-14 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 5.43E-07 NA mr1443 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 3.62E-13 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 3.60E-12 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 2.07E-08 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 1.36E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 8.12E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 1.69E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 3.08E-17 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 3.05E-13 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 4.81E-18 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 5.80E-16 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 9.02E-15 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 5.97E-06 5.49E-21 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 7.17E-17 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 2.88E-10 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 4.03E-16 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209691208 NA 2.55E-07 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251