\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209678228:

Variant ID: vg1209678228 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9678228
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCCGTGAAACCGCAAGAGTCGGCTCTGATACCACTTTGTAACGTCCCACCTCTCCCAGGCTGGGCCCGCGTAACTGCGACACACGCGCCCGTGAAACC[A/G]
CGAGAGTCGGCTCTGGTACCACTTTGTAACGTCCCGCCTCTCCCCGCTTACATCTGACAGCTTTCATAGGTCATAGACTGCTCTCACAGACCAACACAAC

Reverse complement sequence

GTTGTGTTGGTCTGTGAGAGCAGTCTATGACCTATGAAAGCTGTCAGATGTAAGCGGGGAGAGGCGGGACGTTACAAAGTGGTACCAGAGCCGACTCTCG[T/C]
GGTTTCACGGGCGCGTGTGTCGCAGTTACGCGGGCCCAGCCTGGGAGAGGTGGGACGTTACAAAGTGGTATCAGAGCCGACTCTTGCGGTTTCACGGGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.80% 29.80% 0.38% 25.01% NA
All Indica  2759 31.90% 29.10% 0.33% 38.67% NA
All Japonica  1512 77.10% 19.60% 0.13% 3.17% NA
Aus  269 3.70% 80.30% 0.74% 15.24% NA
Indica I  595 29.10% 54.10% 0.17% 16.64% NA
Indica II  465 60.40% 9.70% 0.00% 29.89% NA
Indica III  913 15.40% 21.70% 0.11% 62.76% NA
Indica Intermediate  786 36.40% 30.20% 0.89% 32.57% NA
Temperate Japonica  767 87.50% 6.90% 0.26% 5.35% NA
Tropical Japonica  504 66.70% 32.10% 0.00% 1.19% NA
Japonica Intermediate  241 65.60% 34.00% 0.00% 0.41% NA
VI/Aromatic  96 15.60% 60.40% 3.12% 20.83% NA
Intermediate  90 51.10% 40.00% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209678228 A -> DEL N N silent_mutation Average:72.501; most accessible tissue: Zhenshan97 young leaf, score: 90.815 N N N N
vg1209678228 A -> G LOC_Os12g16870.1 upstream_gene_variant ; 2613.0bp to feature; MODIFIER silent_mutation Average:72.501; most accessible tissue: Zhenshan97 young leaf, score: 90.815 N N N N
vg1209678228 A -> G LOC_Os12g16870-LOC_Os12g16880 intergenic_region ; MODIFIER silent_mutation Average:72.501; most accessible tissue: Zhenshan97 young leaf, score: 90.815 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209678228 A G 0.0 0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209678228 4.99E-06 3.79E-07 mr1229 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678228 NA 3.32E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678228 3.51E-06 1.02E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678228 2.72E-07 2.03E-10 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678228 NA 3.06E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678228 1.96E-06 NA mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678228 NA 2.52E-07 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678228 NA 1.40E-07 mr1425_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251