\
| Variant ID: vg1209676037 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9676037 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, G: 0.11, others allele: 0.00, population size: 97. )
ATCTTGTAAAATTCGTAACTAATTCATATGAACTCGGAATGAGGCCGTTCAAGTCTCTAAATTCATCTAAAATCATGATCTACATGTTTTTTTTTTACTT[T/G]
TTATGTATTGTTCATTTGGTTTTTATTAGTCCTTTTTATTCGTTTTGCGTGTTAGCTTGTCGTTTCTGTCGTTGCGAAGGTCCGTGAGTGCGTCAGAAGT
ACTTCTGACGCACTCACGGACCTTCGCAACGACAGAAACGACAAGCTAACACGCAAAACGAATAAAAAGGACTAATAAAAACCAAATGAACAATACATAA[A/C]
AAGTAAAAAAAAAACATGTAGATCATGATTTTAGATGAATTTAGAGACTTGAACGGCCTCATTCCGAGTTCATATGAATTAGTTACGAATTTTACAAGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 24.90% | 0.72% | 24.35% | NA |
| All Indica | 2759 | 38.20% | 23.20% | 1.05% | 37.59% | NA |
| All Japonica | 1512 | 80.00% | 16.70% | 0.33% | 2.91% | NA |
| Aus | 269 | 9.30% | 74.70% | 0.00% | 15.99% | NA |
| Indica I | 595 | 37.30% | 46.10% | 0.50% | 16.13% | NA |
| Indica II | 465 | 62.20% | 8.00% | 0.43% | 29.46% | NA |
| Indica III | 913 | 21.80% | 15.90% | 1.75% | 60.57% | NA |
| Indica Intermediate | 786 | 43.80% | 23.30% | 1.02% | 31.93% | NA |
| Temperate Japonica | 767 | 87.70% | 6.80% | 0.52% | 4.95% | NA |
| Tropical Japonica | 504 | 74.60% | 24.20% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 66.80% | 32.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 58.30% | 0.00% | 20.83% | NA |
| Intermediate | 90 | 60.00% | 32.20% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209676037 | T -> DEL | N | N | silent_mutation | Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1209676037 | T -> G | LOC_Os12g16870.1 | upstream_gene_variant ; 422.0bp to feature; MODIFIER | silent_mutation | Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1209676037 | T -> G | LOC_Os12g16860.1 | downstream_gene_variant ; 4004.0bp to feature; MODIFIER | silent_mutation | Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1209676037 | T -> G | LOC_Os12g16870-LOC_Os12g16880 | intergenic_region ; MODIFIER | silent_mutation | Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209676037 | NA | 4.26E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209676037 | NA | 3.65E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209676037 | NA | 9.70E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209676037 | NA | 2.05E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209676037 | NA | 5.65E-07 | mr1864 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209676037 | 8.51E-07 | 8.48E-07 | mr1207_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209676037 | NA | 3.38E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209676037 | NA | 1.66E-07 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |