\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209676037:

Variant ID: vg1209676037 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9676037
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, G: 0.11, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTGTAAAATTCGTAACTAATTCATATGAACTCGGAATGAGGCCGTTCAAGTCTCTAAATTCATCTAAAATCATGATCTACATGTTTTTTTTTTACTT[T/G]
TTATGTATTGTTCATTTGGTTTTTATTAGTCCTTTTTATTCGTTTTGCGTGTTAGCTTGTCGTTTCTGTCGTTGCGAAGGTCCGTGAGTGCGTCAGAAGT

Reverse complement sequence

ACTTCTGACGCACTCACGGACCTTCGCAACGACAGAAACGACAAGCTAACACGCAAAACGAATAAAAAGGACTAATAAAAACCAAATGAACAATACATAA[A/C]
AAGTAAAAAAAAAACATGTAGATCATGATTTTAGATGAATTTAGAGACTTGAACGGCCTCATTCCGAGTTCATATGAATTAGTTACGAATTTTACAAGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 24.90% 0.72% 24.35% NA
All Indica  2759 38.20% 23.20% 1.05% 37.59% NA
All Japonica  1512 80.00% 16.70% 0.33% 2.91% NA
Aus  269 9.30% 74.70% 0.00% 15.99% NA
Indica I  595 37.30% 46.10% 0.50% 16.13% NA
Indica II  465 62.20% 8.00% 0.43% 29.46% NA
Indica III  913 21.80% 15.90% 1.75% 60.57% NA
Indica Intermediate  786 43.80% 23.30% 1.02% 31.93% NA
Temperate Japonica  767 87.70% 6.80% 0.52% 4.95% NA
Tropical Japonica  504 74.60% 24.20% 0.00% 1.19% NA
Japonica Intermediate  241 66.80% 32.80% 0.41% 0.00% NA
VI/Aromatic  96 20.80% 58.30% 0.00% 20.83% NA
Intermediate  90 60.00% 32.20% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209676037 T -> DEL N N silent_mutation Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1209676037 T -> G LOC_Os12g16870.1 upstream_gene_variant ; 422.0bp to feature; MODIFIER silent_mutation Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1209676037 T -> G LOC_Os12g16860.1 downstream_gene_variant ; 4004.0bp to feature; MODIFIER silent_mutation Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1209676037 T -> G LOC_Os12g16870-LOC_Os12g16880 intergenic_region ; MODIFIER silent_mutation Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209676037 NA 4.26E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037 NA 3.65E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037 NA 9.70E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037 NA 2.05E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037 NA 5.65E-07 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037 8.51E-07 8.48E-07 mr1207_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037 NA 3.38E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037 NA 1.66E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251