Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209593460:

Variant ID: vg1209593460 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9593460
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.14, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTAGTCACAGTCTATGAGATTTGGGCGATCTCTAGATACTCATGAAAAGGCCTGTAGTTTGACTTATATGCTCCAAACAGAGGGGATGCGAACGGCAG[C/T]
CCAGTACCAGTCAAGGGTTTGAGTGAAACCTAATCACACAAGACTGATAATTCAAGGCATAGTCCATTGTTCAGTTGTGGTTTGATGTAGCTCATTTCCT

Reverse complement sequence

AGGAAATGAGCTACATCAAACCACAACTGAACAATGGACTATGCCTTGAATTATCAGTCTTGTGTGATTAGGTTTCACTCAAACCCTTGACTGGTACTGG[G/A]
CTGCCGTTCGCATCCCCTCTGTTTGGAGCATATAAGTCAAACTACAGGCCTTTTCATGAGTATCTAGAGATCGCCCAAATCTCATAGACTGTGACTAGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.80%	45.20%	0.06%	0.00%	NA
All Indica	2759	29.40%	70.60%	0.04%	0.00%	NA
All Japonica	1512	91.10%	8.90%	0.07%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	47.70%	52.30%	0.00%	0.00%	NA
Indica II	465	20.00%	80.00%	0.00%	0.00%	NA
Indica III	913	21.50%	78.50%	0.00%	0.00%	NA
Indica Intermediate	786	30.30%	69.60%	0.13%	0.00%	NA
Temperate Japonica	767	91.90%	8.00%	0.13%	0.00%	NA
Tropical Japonica	504	90.90%	9.10%	0.00%	0.00%	NA
Japonica Intermediate	241	88.80%	11.20%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209593460	C -> T	LOC_Os12g16730.1	downstream_gene_variant ; 3172.0bp to feature; MODIFIER	silent_mutation	Average:38.962; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N
vg1209593460	C -> T	LOC_Os12g16740.1	downstream_gene_variant ; 815.0bp to feature; MODIFIER	silent_mutation	Average:38.962; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N
vg1209593460	C -> T	LOC_Os12g16740-LOC_Os12g16750	intergenic_region ; MODIFIER	silent_mutation	Average:38.962; most accessible tissue: Minghui63 young leaf, score: 66.656	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209593460	9.18E-07	NA	mr1017	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460	3.67E-06	NA	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460	NA	8.36E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460	NA	2.52E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460	NA	5.68E-06	mr1622_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460	NA	1.99E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460	NA	6.75E-07	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460	NA	3.57E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251