\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209593460:

Variant ID: vg1209593460 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9593460
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.14, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTAGTCACAGTCTATGAGATTTGGGCGATCTCTAGATACTCATGAAAAGGCCTGTAGTTTGACTTATATGCTCCAAACAGAGGGGATGCGAACGGCAG[C/T]
CCAGTACCAGTCAAGGGTTTGAGTGAAACCTAATCACACAAGACTGATAATTCAAGGCATAGTCCATTGTTCAGTTGTGGTTTGATGTAGCTCATTTCCT

Reverse complement sequence

AGGAAATGAGCTACATCAAACCACAACTGAACAATGGACTATGCCTTGAATTATCAGTCTTGTGTGATTAGGTTTCACTCAAACCCTTGACTGGTACTGG[G/A]
CTGCCGTTCGCATCCCCTCTGTTTGGAGCATATAAGTCAAACTACAGGCCTTTTCATGAGTATCTAGAGATCGCCCAAATCTCATAGACTGTGACTAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 45.20% 0.06% 0.00% NA
All Indica  2759 29.40% 70.60% 0.04% 0.00% NA
All Japonica  1512 91.10% 8.90% 0.07% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 47.70% 52.30% 0.00% 0.00% NA
Indica II  465 20.00% 80.00% 0.00% 0.00% NA
Indica III  913 21.50% 78.50% 0.00% 0.00% NA
Indica Intermediate  786 30.30% 69.60% 0.13% 0.00% NA
Temperate Japonica  767 91.90% 8.00% 0.13% 0.00% NA
Tropical Japonica  504 90.90% 9.10% 0.00% 0.00% NA
Japonica Intermediate  241 88.80% 11.20% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209593460 C -> T LOC_Os12g16730.1 downstream_gene_variant ; 3172.0bp to feature; MODIFIER silent_mutation Average:38.962; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1209593460 C -> T LOC_Os12g16740.1 downstream_gene_variant ; 815.0bp to feature; MODIFIER silent_mutation Average:38.962; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1209593460 C -> T LOC_Os12g16740-LOC_Os12g16750 intergenic_region ; MODIFIER silent_mutation Average:38.962; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209593460 9.18E-07 NA mr1017 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460 3.67E-06 NA mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460 NA 8.36E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460 NA 2.52E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460 NA 5.68E-06 mr1622_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460 NA 1.99E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460 NA 6.75E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593460 NA 3.57E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251