\
| Variant ID: vg1209431558 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 9431558 |
| Reference Allele: C | Alternative Allele: CTTCATGAGTATCATCCTTTATCGTGT,T |
| Primary Allele: C | Secondary Allele: CTTCATGAGTATCATCCTTT ATCGTGT |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )
ATCTACTTGTAGTCAGCTATTATTTGATTTGGCTTGGTGGTATCCTCTATTTACGTATCATTTGTTGATAATTGCCTACTTAGTATCATCCTTTATCGTG[C/CTTCATGAGTATCATCCTTTATCGTGT,T]
TTCATGACAAACATGTTCATTGGATATGAGGACGCACTGTGCATGGATGTCATGTAAGCAATATGGCTTGGCAATTGGTGTATAGTAATTTGTATATAGA
TCTATATACAAATTACTATACACCAATTGCCAAGCCATATTGCTTACATGACATCCATGCACAGTGCGTCCTCATATCCAATGAACATGTTTGTCATGAA[G/ACACGATAAAGGATGATACTCATGAAG,A]
CACGATAAAGGATGATACTAAGTAGGCAATTATCAACAAATGATACGTAAATAGAGGATACCACCAAGCCAAATCAAATAATAGCTGACTACAAGTAGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of CTTCATGAGTATCATCCTTT ATCGTGT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.90% | 12.40% | 1.04% | 3.49% | T: 0.11% |
| All Indica | 2759 | 79.40% | 13.80% | 1.49% | 5.15% | T: 0.14% |
| All Japonica | 1512 | 86.80% | 12.50% | 0.33% | 0.33% | T: 0.07% |
| Aus | 269 | 92.20% | 1.10% | 0.37% | 6.32% | NA |
| Indica I | 595 | 58.00% | 28.60% | 3.19% | 9.92% | T: 0.34% |
| Indica II | 465 | 93.50% | 4.90% | 0.86% | 0.43% | T: 0.22% |
| Indica III | 913 | 87.60% | 7.00% | 1.10% | 4.27% | NA |
| Indica Intermediate | 786 | 77.70% | 15.80% | 1.02% | 5.34% | T: 0.13% |
| Temperate Japonica | 767 | 96.20% | 3.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 79.00% | 19.40% | 0.99% | 0.40% | T: 0.20% |
| Japonica Intermediate | 241 | 73.00% | 26.10% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 81.10% | 16.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209431558 | C -> DEL | N | N | silent_mutation | Average:54.302; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1209431558 | C -> CTTCATGAGTATCATCCTTTATCGTGT | LOC_Os12g16470.1 | upstream_gene_variant ; 3436.0bp to feature; MODIFIER | silent_mutation | Average:54.302; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1209431558 | C -> CTTCATGAGTATCATCCTTTATCGTGT | LOC_Os12g16480.1 | downstream_gene_variant ; 4375.0bp to feature; MODIFIER | silent_mutation | Average:54.302; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1209431558 | C -> CTTCATGAGTATCATCCTTTATCGTGT | LOC_Os12g16460-LOC_Os12g16470 | intergenic_region ; MODIFIER | silent_mutation | Average:54.302; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1209431558 | C -> T | LOC_Os12g16470.1 | upstream_gene_variant ; 3437.0bp to feature; MODIFIER | silent_mutation | Average:54.302; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1209431558 | C -> T | LOC_Os12g16480.1 | downstream_gene_variant ; 4376.0bp to feature; MODIFIER | silent_mutation | Average:54.302; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1209431558 | C -> T | LOC_Os12g16460-LOC_Os12g16470 | intergenic_region ; MODIFIER | silent_mutation | Average:54.302; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209431558 | NA | 2.96E-07 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209431558 | NA | 4.33E-09 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209431558 | NA | 7.21E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209431558 | NA | 9.61E-06 | mr1170 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209431558 | NA | 2.28E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209431558 | 8.27E-08 | 8.27E-08 | mr1184 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209431558 | NA | 9.06E-06 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209431558 | NA | 2.49E-07 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209431558 | 1.54E-06 | 1.54E-06 | mr1663 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209431558 | NA | 4.14E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |