\
| Variant ID: vg1209223420 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9223420 |
| Reference Allele: T | Alternative Allele: G,A |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCGGAGGTTGCTGGTGTGGCCTAACCTCTGGTTTGATAGGTAGCCGATGTTCTACAATCGATCGGTTGAGTCCTGGTATCTCGTAATACTCCCAAGCGAA[T/G,A]
CAATCTCTAAACTCTTTCAAGAGCTCTATCAGCTTGGTTCTAAATTCTGGAGATAAGTTCTTACTAATAAATGTCGGCCTTGGCCGATCGCCTGGACCTA
TAGGTCCAGGCGATCGGCCAAGGCCGACATTTATTAGTAAGAACTTATCTCCAGAATTTAGAACCAAGCTGATAGAGCTCTTGAAAGAGTTTAGAGATTG[A/C,T]
TTCGCTTGGGAGTATTACGAGATACCAGGACTCAACCGATCGATTGTAGAACATCGGCTACCTATCAAACCAGAGGTTAGGCCACACCAGCAACCTCCGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.10% | 26.10% | 7.32% | 1.40% | A: 0.06% |
| All Indica | 2759 | 43.70% | 43.10% | 11.74% | 1.27% | A: 0.11% |
| All Japonica | 1512 | 96.60% | 1.20% | 0.13% | 2.05% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 57.50% | 27.10% | 15.13% | 0.34% | NA |
| Indica II | 465 | 51.20% | 38.30% | 9.68% | 0.86% | NA |
| Indica III | 913 | 29.20% | 55.50% | 13.25% | 1.75% | A: 0.22% |
| Indica Intermediate | 786 | 45.80% | 43.80% | 8.65% | 1.65% | A: 0.13% |
| Temperate Japonica | 767 | 95.60% | 0.80% | 0.13% | 3.52% | NA |
| Tropical Japonica | 504 | 96.60% | 2.40% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 11.50% | 20.83% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209223420 | T -> A | LOC_Os12g16140.1 | downstream_gene_variant ; 3412.0bp to feature; MODIFIER | silent_mutation | Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg1209223420 | T -> A | LOC_Os12g16150.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg1209223420 | T -> DEL | N | N | silent_mutation | Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg1209223420 | T -> G | LOC_Os12g16140.1 | downstream_gene_variant ; 3412.0bp to feature; MODIFIER | silent_mutation | Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg1209223420 | T -> G | LOC_Os12g16150.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209223420 | NA | 9.63E-06 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209223420 | NA | 3.25E-06 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209223420 | NA | 9.47E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209223420 | NA | 1.45E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209223420 | NA | 7.91E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209223420 | 3.21E-06 | NA | mr1632 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209223420 | NA | 5.13E-07 | mr1364_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |