Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209223420:

Variant ID: vg1209223420 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9223420
Reference Allele: T	Alternative Allele: G,A
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGGAGGTTGCTGGTGTGGCCTAACCTCTGGTTTGATAGGTAGCCGATGTTCTACAATCGATCGGTTGAGTCCTGGTATCTCGTAATACTCCCAAGCGAA[T/G,A]
CAATCTCTAAACTCTTTCAAGAGCTCTATCAGCTTGGTTCTAAATTCTGGAGATAAGTTCTTACTAATAAATGTCGGCCTTGGCCGATCGCCTGGACCTA

Reverse complement sequence

TAGGTCCAGGCGATCGGCCAAGGCCGACATTTATTAGTAAGAACTTATCTCCAGAATTTAGAACCAAGCTGATAGAGCTCTTGAAAGAGTTTAGAGATTG[A/C,T]
TTCGCTTGGGAGTATTACGAGATACCAGGACTCAACCGATCGATTGTAGAACATCGGCTACCTATCAAACCAGAGGTTAGGCCACACCAGCAACCTCCGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.10%	26.10%	7.32%	1.40%	A: 0.06%
All Indica	2759	43.70%	43.10%	11.74%	1.27%	A: 0.11%
All Japonica	1512	96.60%	1.20%	0.13%	2.05%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	57.50%	27.10%	15.13%	0.34%	NA
Indica II	465	51.20%	38.30%	9.68%	0.86%	NA
Indica III	913	29.20%	55.50%	13.25%	1.75%	A: 0.22%
Indica Intermediate	786	45.80%	43.80%	8.65%	1.65%	A: 0.13%
Temperate Japonica	767	95.60%	0.80%	0.13%	3.52%	NA
Tropical Japonica	504	96.60%	2.40%	0.20%	0.79%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	67.70%	11.50%	20.83%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209223420	T -> A	LOC_Os12g16140.1	downstream_gene_variant ; 3412.0bp to feature; MODIFIER	silent_mutation	Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg1209223420	T -> A	LOC_Os12g16150.1	intron_variant ; MODIFIER	silent_mutation	Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg1209223420	T -> DEL	N	N	silent_mutation	Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg1209223420	T -> G	LOC_Os12g16140.1	downstream_gene_variant ; 3412.0bp to feature; MODIFIER	silent_mutation	Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg1209223420	T -> G	LOC_Os12g16150.1	intron_variant ; MODIFIER	silent_mutation	Average:41.53; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209223420	NA	9.63E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209223420	NA	3.25E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209223420	NA	9.47E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209223420	NA	1.45E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209223420	NA	7.91E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209223420	3.21E-06	NA	mr1632	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209223420	NA	5.13E-07	mr1364_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251