Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209083240:

Variant ID: vg1209083240 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9083240
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, G: 0.48, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

AGGATCTGTGTGACTTGCCTTGCAGTAATCAGTCTTGAATTAATCTTCTTGAACACTTCCGACGCACTCACGAATCTTCGCAACGACGGAAACGGCAAGC[T/G]
AACACGCAAAACGAAGAAAAAGACTAATAAAAACCAAATAATCAGTACACATAAAGTAAACAAACATGTAGATCATGATTTTAGATGAATTTAGCAACTT

Reverse complement sequence

AAGTTGCTAAATTCATCTAAAATCATGATCTACATGTTTGTTTACTTTATGTGTACTGATTATTTGGTTTTTATTAGTCTTTTTCTTCGTTTTGCGTGTT[A/C]
GCTTGCCGTTTCCGTCGTTGCGAAGATTCGTGAGTGCGTCGGAAGTGTTCAAGAAGATTAATTCAAGACTGATTACTGCAAGGCAAGTCACACAGATCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	34.00%	0.83%	6.24%	NA
All Indica	2759	85.40%	3.60%	1.34%	9.75%	NA
All Japonica	1512	5.10%	94.20%	0.00%	0.66%	NA
Aus	269	90.00%	4.50%	0.37%	5.20%	NA
Indica I	595	81.30%	2.90%	0.67%	15.13%	NA
Indica II	465	87.70%	5.20%	0.22%	6.88%	NA
Indica III	913	88.20%	2.10%	2.41%	7.34%	NA
Indica Intermediate	786	83.70%	4.80%	1.27%	10.18%	NA
Temperate Japonica	767	6.50%	92.20%	0.00%	1.30%	NA
Tropical Japonica	504	4.00%	96.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	22.90%	1.04%	0.00%	NA
Intermediate	90	40.00%	57.80%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209083240	T -> DEL	N	N	silent_mutation	Average:44.479; most accessible tissue: Zhenshan97 flag leaf, score: 83.994	N	N	N	N
vg1209083240	T -> G	LOC_Os12g15930.1	upstream_gene_variant ; 205.0bp to feature; MODIFIER	silent_mutation	Average:44.479; most accessible tissue: Zhenshan97 flag leaf, score: 83.994	N	N	N	N
vg1209083240	T -> G	LOC_Os12g15950.1	downstream_gene_variant ; 4622.0bp to feature; MODIFIER	silent_mutation	Average:44.479; most accessible tissue: Zhenshan97 flag leaf, score: 83.994	N	N	N	N
vg1209083240	T -> G	LOC_Os12g15920-LOC_Os12g15930	intergenic_region ; MODIFIER	silent_mutation	Average:44.479; most accessible tissue: Zhenshan97 flag leaf, score: 83.994	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209083240	NA	1.45E-36	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240	1.36E-06	3.24E-08	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240	1.49E-06	2.94E-30	mr1350_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240	NA	5.76E-08	mr1350_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240	NA	2.19E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240	NA	5.61E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240	NA	2.52E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240	NA	2.53E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251