\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209083240:

Variant ID: vg1209083240 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9083240
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, G: 0.48, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AGGATCTGTGTGACTTGCCTTGCAGTAATCAGTCTTGAATTAATCTTCTTGAACACTTCCGACGCACTCACGAATCTTCGCAACGACGGAAACGGCAAGC[T/G]
AACACGCAAAACGAAGAAAAAGACTAATAAAAACCAAATAATCAGTACACATAAAGTAAACAAACATGTAGATCATGATTTTAGATGAATTTAGCAACTT

Reverse complement sequence

AAGTTGCTAAATTCATCTAAAATCATGATCTACATGTTTGTTTACTTTATGTGTACTGATTATTTGGTTTTTATTAGTCTTTTTCTTCGTTTTGCGTGTT[A/C]
GCTTGCCGTTTCCGTCGTTGCGAAGATTCGTGAGTGCGTCGGAAGTGTTCAAGAAGATTAATTCAAGACTGATTACTGCAAGGCAAGTCACACAGATCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 34.00% 0.83% 6.24% NA
All Indica  2759 85.40% 3.60% 1.34% 9.75% NA
All Japonica  1512 5.10% 94.20% 0.00% 0.66% NA
Aus  269 90.00% 4.50% 0.37% 5.20% NA
Indica I  595 81.30% 2.90% 0.67% 15.13% NA
Indica II  465 87.70% 5.20% 0.22% 6.88% NA
Indica III  913 88.20% 2.10% 2.41% 7.34% NA
Indica Intermediate  786 83.70% 4.80% 1.27% 10.18% NA
Temperate Japonica  767 6.50% 92.20% 0.00% 1.30% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 22.90% 1.04% 0.00% NA
Intermediate  90 40.00% 57.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209083240 T -> DEL N N silent_mutation Average:44.479; most accessible tissue: Zhenshan97 flag leaf, score: 83.994 N N N N
vg1209083240 T -> G LOC_Os12g15930.1 upstream_gene_variant ; 205.0bp to feature; MODIFIER silent_mutation Average:44.479; most accessible tissue: Zhenshan97 flag leaf, score: 83.994 N N N N
vg1209083240 T -> G LOC_Os12g15950.1 downstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:44.479; most accessible tissue: Zhenshan97 flag leaf, score: 83.994 N N N N
vg1209083240 T -> G LOC_Os12g15920-LOC_Os12g15930 intergenic_region ; MODIFIER silent_mutation Average:44.479; most accessible tissue: Zhenshan97 flag leaf, score: 83.994 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209083240 NA 1.45E-36 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240 1.36E-06 3.24E-08 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240 1.49E-06 2.94E-30 mr1350_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240 NA 5.76E-08 mr1350_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240 NA 2.19E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240 NA 5.61E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240 NA 2.52E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209083240 NA 2.53E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251