\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209064091:

Variant ID: vg1209064091 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9064091
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CATGGAACATGAATAATTGAAACCGGAAACAAAGAACGAGATTGAAACCATATTACACATCTATGGCAAGCATGGAACTTAAATTATTTAACCAAAATCA[G/A]
AATCCTGAATATTCAAACAAGAATAACATCGTAAACACAAGATAAACTTGAAATCTAAATGGTATGAACAACAGCCTAAACATAAGCAGTCACATATCAC

Reverse complement sequence

GTGATATGTGACTGCTTATGTTTAGGCTGTTGTTCATACCATTTAGATTTCAAGTTTATCTTGTGTTTACGATGTTATTCTTGTTTGAATATTCAGGATT[C/T]
TGATTTTGGTTAAATAATTTAAGTTCCATGCTTGCCATAGATGTGTAATATGGTTTCAATCTCGTTCTTTGTTTCCGGTTTCAATTATTCATGTTCCATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 37.00% 0.23% 0.06% NA
All Indica  2759 41.20% 58.40% 0.36% 0.07% NA
All Japonica  1512 95.50% 4.50% 0.00% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 54.60% 44.70% 0.67% 0.00% NA
Indica II  465 43.90% 55.70% 0.22% 0.22% NA
Indica III  913 31.10% 68.70% 0.22% 0.00% NA
Indica Intermediate  786 41.10% 58.40% 0.38% 0.13% NA
Temperate Japonica  767 93.40% 6.60% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 80.00% 17.80% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209064091 G -> DEL N N silent_mutation Average:38.94; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg1209064091 G -> A LOC_Os12g15920.1 upstream_gene_variant ; 4927.0bp to feature; MODIFIER silent_mutation Average:38.94; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg1209064091 G -> A LOC_Os12g15910-LOC_Os12g15920 intergenic_region ; MODIFIER silent_mutation Average:38.94; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209064091 6.36E-06 7.59E-11 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091 NA 3.45E-09 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091 NA 1.11E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091 NA 1.94E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091 4.30E-06 9.52E-10 mr1425_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091 NA 5.17E-06 mr1425_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091 NA 9.84E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091 NA 9.94E-09 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251