Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209064091:

Variant ID: vg1209064091 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9064091
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CATGGAACATGAATAATTGAAACCGGAAACAAAGAACGAGATTGAAACCATATTACACATCTATGGCAAGCATGGAACTTAAATTATTTAACCAAAATCA[G/A]
AATCCTGAATATTCAAACAAGAATAACATCGTAAACACAAGATAAACTTGAAATCTAAATGGTATGAACAACAGCCTAAACATAAGCAGTCACATATCAC

Reverse complement sequence

GTGATATGTGACTGCTTATGTTTAGGCTGTTGTTCATACCATTTAGATTTCAAGTTTATCTTGTGTTTACGATGTTATTCTTGTTTGAATATTCAGGATT[C/T]
TGATTTTGGTTAAATAATTTAAGTTCCATGCTTGCCATAGATGTGTAATATGGTTTCAATCTCGTTCTTTGTTTCCGGTTTCAATTATTCATGTTCCATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	37.00%	0.23%	0.06%	NA
All Indica	2759	41.20%	58.40%	0.36%	0.07%	NA
All Japonica	1512	95.50%	4.50%	0.00%	0.00%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	54.60%	44.70%	0.67%	0.00%	NA
Indica II	465	43.90%	55.70%	0.22%	0.22%	NA
Indica III	913	31.10%	68.70%	0.22%	0.00%	NA
Indica Intermediate	786	41.10%	58.40%	0.38%	0.13%	NA
Temperate Japonica	767	93.40%	6.60%	0.00%	0.00%	NA
Tropical Japonica	504	96.80%	3.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	80.00%	17.80%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209064091	G -> DEL	N	N	silent_mutation	Average:38.94; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg1209064091	G -> A	LOC_Os12g15920.1	upstream_gene_variant ; 4927.0bp to feature; MODIFIER	silent_mutation	Average:38.94; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg1209064091	G -> A	LOC_Os12g15910-LOC_Os12g15920	intergenic_region ; MODIFIER	silent_mutation	Average:38.94; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209064091	6.36E-06	7.59E-11	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091	NA	3.45E-09	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091	NA	1.11E-08	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091	NA	1.94E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091	4.30E-06	9.52E-10	mr1425_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091	NA	5.17E-06	mr1425_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091	NA	9.84E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209064091	NA	9.94E-09	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251