\
| Variant ID: vg1209064091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9064091 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 86. )
CATGGAACATGAATAATTGAAACCGGAAACAAAGAACGAGATTGAAACCATATTACACATCTATGGCAAGCATGGAACTTAAATTATTTAACCAAAATCA[G/A]
AATCCTGAATATTCAAACAAGAATAACATCGTAAACACAAGATAAACTTGAAATCTAAATGGTATGAACAACAGCCTAAACATAAGCAGTCACATATCAC
GTGATATGTGACTGCTTATGTTTAGGCTGTTGTTCATACCATTTAGATTTCAAGTTTATCTTGTGTTTACGATGTTATTCTTGTTTGAATATTCAGGATT[C/T]
TGATTTTGGTTAAATAATTTAAGTTCCATGCTTGCCATAGATGTGTAATATGGTTTCAATCTCGTTCTTTGTTTCCGGTTTCAATTATTCATGTTCCATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 37.00% | 0.23% | 0.06% | NA |
| All Indica | 2759 | 41.20% | 58.40% | 0.36% | 0.07% | NA |
| All Japonica | 1512 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 54.60% | 44.70% | 0.67% | 0.00% | NA |
| Indica II | 465 | 43.90% | 55.70% | 0.22% | 0.22% | NA |
| Indica III | 913 | 31.10% | 68.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 41.10% | 58.40% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 35.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 17.80% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209064091 | G -> DEL | N | N | silent_mutation | Average:38.94; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg1209064091 | G -> A | LOC_Os12g15920.1 | upstream_gene_variant ; 4927.0bp to feature; MODIFIER | silent_mutation | Average:38.94; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg1209064091 | G -> A | LOC_Os12g15910-LOC_Os12g15920 | intergenic_region ; MODIFIER | silent_mutation | Average:38.94; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209064091 | 6.36E-06 | 7.59E-11 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209064091 | NA | 3.45E-09 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209064091 | NA | 1.11E-08 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209064091 | NA | 1.94E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209064091 | 4.30E-06 | 9.52E-10 | mr1425_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209064091 | NA | 5.17E-06 | mr1425_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209064091 | NA | 9.84E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209064091 | NA | 9.94E-09 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |