\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209048534:

Variant ID: vg1209048534 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9048534
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.21, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CTACTTGGAAACGGCGTGACCTGCGATATAAAAGGGATCCCCTGGGAGGACCTAAAGGGGGAATCTAATAGCCAACATCACCACCACAGCCTACGAAGTC[G/A]
GAGCCTGCGGAAGCCAGATTGCCGAGAGGTGTAGTCGGATTAACCCGATACGATCTCGTCGGTTTCATCGAGTTCCATCTTTCCCTTTGTAACTTGTGAT

Reverse complement sequence

ATCACAAGTTACAAAGGGAAAGATGGAACTCGATGAAACCGACGAGATCGTATCGGGTTAATCCGACTACACCTCTCGGCAATCTGGCTTCCGCAGGCTC[C/T]
GACTTCGTAGGCTGTGGTGGTGATGTTGGCTATTAGATTCCCCCTTTAGGTCCTCCCAGGGGATCCCTTTTATATCGCAGGTCACGCCGTTTCCAAGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 38.80% 1.10% 11.00% NA
All Indica  2759 28.30% 52.70% 1.78% 17.22% NA
All Japonica  1512 94.80% 4.20% 0.00% 0.99% NA
Aus  269 8.60% 80.70% 1.12% 9.67% NA
Indica I  595 25.70% 35.00% 1.34% 37.98% NA
Indica II  465 25.80% 51.20% 1.29% 21.72% NA
Indica III  913 30.80% 63.50% 1.75% 3.94% NA
Indica Intermediate  786 29.00% 54.30% 2.42% 14.25% NA
Temperate Japonica  767 93.20% 5.60% 0.00% 1.17% NA
Tropical Japonica  504 96.00% 3.40% 0.00% 0.60% NA
Japonica Intermediate  241 97.50% 1.20% 0.00% 1.24% NA
VI/Aromatic  96 26.00% 71.90% 0.00% 2.08% NA
Intermediate  90 63.30% 34.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209048534 G -> DEL N N silent_mutation Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg1209048534 G -> A LOC_Os12g15880.1 upstream_gene_variant ; 430.0bp to feature; MODIFIER silent_mutation Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg1209048534 G -> A LOC_Os12g15890.1 upstream_gene_variant ; 2695.0bp to feature; MODIFIER silent_mutation Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg1209048534 G -> A LOC_Os12g15900.1 upstream_gene_variant ; 3658.0bp to feature; MODIFIER silent_mutation Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg1209048534 G -> A LOC_Os12g15870.1 downstream_gene_variant ; 1083.0bp to feature; MODIFIER silent_mutation Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg1209048534 G -> A LOC_Os12g15870-LOC_Os12g15880 intergenic_region ; MODIFIER silent_mutation Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209048534 NA 8.80E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 4.39E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 1.64E-10 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 3.19E-09 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 1.14E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 4.48E-06 1.80E-07 mr1851 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 5.58E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 7.02E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 6.48E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 4.67E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 5.12E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209048534 NA 2.20E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251