| Variant ID: vg1209048534 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9048534 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.21, others allele: 0.00, population size: 63. )
CTACTTGGAAACGGCGTGACCTGCGATATAAAAGGGATCCCCTGGGAGGACCTAAAGGGGGAATCTAATAGCCAACATCACCACCACAGCCTACGAAGTC[G/A]
GAGCCTGCGGAAGCCAGATTGCCGAGAGGTGTAGTCGGATTAACCCGATACGATCTCGTCGGTTTCATCGAGTTCCATCTTTCCCTTTGTAACTTGTGAT
ATCACAAGTTACAAAGGGAAAGATGGAACTCGATGAAACCGACGAGATCGTATCGGGTTAATCCGACTACACCTCTCGGCAATCTGGCTTCCGCAGGCTC[C/T]
GACTTCGTAGGCTGTGGTGGTGATGTTGGCTATTAGATTCCCCCTTTAGGTCCTCCCAGGGGATCCCTTTTATATCGCAGGTCACGCCGTTTCCAAGTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.10% | 38.80% | 1.10% | 11.00% | NA |
| All Indica | 2759 | 28.30% | 52.70% | 1.78% | 17.22% | NA |
| All Japonica | 1512 | 94.80% | 4.20% | 0.00% | 0.99% | NA |
| Aus | 269 | 8.60% | 80.70% | 1.12% | 9.67% | NA |
| Indica I | 595 | 25.70% | 35.00% | 1.34% | 37.98% | NA |
| Indica II | 465 | 25.80% | 51.20% | 1.29% | 21.72% | NA |
| Indica III | 913 | 30.80% | 63.50% | 1.75% | 3.94% | NA |
| Indica Intermediate | 786 | 29.00% | 54.30% | 2.42% | 14.25% | NA |
| Temperate Japonica | 767 | 93.20% | 5.60% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 96.00% | 3.40% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 26.00% | 71.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 63.30% | 34.40% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209048534 | G -> DEL | N | N | silent_mutation | Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg1209048534 | G -> A | LOC_Os12g15880.1 | upstream_gene_variant ; 430.0bp to feature; MODIFIER | silent_mutation | Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg1209048534 | G -> A | LOC_Os12g15890.1 | upstream_gene_variant ; 2695.0bp to feature; MODIFIER | silent_mutation | Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg1209048534 | G -> A | LOC_Os12g15900.1 | upstream_gene_variant ; 3658.0bp to feature; MODIFIER | silent_mutation | Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg1209048534 | G -> A | LOC_Os12g15870.1 | downstream_gene_variant ; 1083.0bp to feature; MODIFIER | silent_mutation | Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg1209048534 | G -> A | LOC_Os12g15870-LOC_Os12g15880 | intergenic_region ; MODIFIER | silent_mutation | Average:22.054; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209048534 | NA | 8.80E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 4.39E-07 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 1.64E-10 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 3.19E-09 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 1.14E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | 4.48E-06 | 1.80E-07 | mr1851 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 5.58E-07 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 7.02E-08 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 6.48E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 4.67E-07 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 5.12E-07 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209048534 | NA | 2.20E-06 | mr1882_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |