\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208947655:

Variant ID: vg1208947655 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8947655
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.52, A: 0.48, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TATCTCTGTGTTTGCAAAGTGCACCAACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATTGCTCTCAAAAGC[A/G]
ATACAGGGAAGCCTCACGCTCCCCCTTTATTTATACCCAAGGTAGGCAGCCTAAAGCCACGGAACAAACTCATACTAGAAGTCCTAAACACCTTAGGAAA

Reverse complement sequence

TTTCCTAAGGTGTTTAGGACTTCTAGTATGAGTTTGTTCCGTGGCTTTAGGCTGCCTACCTTGGGTATAAATAAAGGGGGAGCGTGAGGCTTCCCTGTAT[T/C]
GCTTTTGAGAGCAATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGCAAACACAGAGATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.70% 36.60% 2.20% 21.52% NA
All Indica  2759 54.00% 7.50% 3.48% 34.98% NA
All Japonica  1512 4.40% 94.50% 0.07% 1.06% NA
Aus  269 81.00% 7.40% 1.86% 9.67% NA
Indica I  595 35.50% 13.60% 3.03% 47.90% NA
Indica II  465 51.20% 6.50% 5.38% 36.99% NA
Indica III  913 66.70% 3.60% 2.52% 27.16% NA
Indica Intermediate  786 55.10% 8.00% 3.82% 33.08% NA
Temperate Japonica  767 6.00% 92.80% 0.13% 1.04% NA
Tropical Japonica  504 3.40% 95.60% 0.00% 0.99% NA
Japonica Intermediate  241 1.20% 97.50% 0.00% 1.24% NA
VI/Aromatic  96 71.90% 24.00% 1.04% 3.12% NA
Intermediate  90 34.40% 56.70% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208947655 A -> DEL N N silent_mutation Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg1208947655 A -> G LOC_Os12g15660.1 upstream_gene_variant ; 4211.0bp to feature; MODIFIER silent_mutation Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg1208947655 A -> G LOC_Os12g15670.1 downstream_gene_variant ; 2432.0bp to feature; MODIFIER silent_mutation Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg1208947655 A -> G LOC_Os12g15660-LOC_Os12g15670 intergenic_region ; MODIFIER silent_mutation Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208947655 NA 5.10E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655 NA 2.18E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655 NA 5.94E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655 NA 9.70E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655 9.24E-07 2.59E-08 mr1889_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655 NA 2.46E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655 2.03E-06 1.16E-08 mr1907_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251