\
| Variant ID: vg1208947655 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8947655 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.52, A: 0.48, others allele: 0.00, population size: 81. )
TATCTCTGTGTTTGCAAAGTGCACCAACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATTGCTCTCAAAAGC[A/G]
ATACAGGGAAGCCTCACGCTCCCCCTTTATTTATACCCAAGGTAGGCAGCCTAAAGCCACGGAACAAACTCATACTAGAAGTCCTAAACACCTTAGGAAA
TTTCCTAAGGTGTTTAGGACTTCTAGTATGAGTTTGTTCCGTGGCTTTAGGCTGCCTACCTTGGGTATAAATAAAGGGGGAGCGTGAGGCTTCCCTGTAT[T/C]
GCTTTTGAGAGCAATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGCAAACACAGAGATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 36.60% | 2.20% | 21.52% | NA |
| All Indica | 2759 | 54.00% | 7.50% | 3.48% | 34.98% | NA |
| All Japonica | 1512 | 4.40% | 94.50% | 0.07% | 1.06% | NA |
| Aus | 269 | 81.00% | 7.40% | 1.86% | 9.67% | NA |
| Indica I | 595 | 35.50% | 13.60% | 3.03% | 47.90% | NA |
| Indica II | 465 | 51.20% | 6.50% | 5.38% | 36.99% | NA |
| Indica III | 913 | 66.70% | 3.60% | 2.52% | 27.16% | NA |
| Indica Intermediate | 786 | 55.10% | 8.00% | 3.82% | 33.08% | NA |
| Temperate Japonica | 767 | 6.00% | 92.80% | 0.13% | 1.04% | NA |
| Tropical Japonica | 504 | 3.40% | 95.60% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.50% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 71.90% | 24.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 34.40% | 56.70% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208947655 | A -> DEL | N | N | silent_mutation | Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| vg1208947655 | A -> G | LOC_Os12g15660.1 | upstream_gene_variant ; 4211.0bp to feature; MODIFIER | silent_mutation | Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| vg1208947655 | A -> G | LOC_Os12g15670.1 | downstream_gene_variant ; 2432.0bp to feature; MODIFIER | silent_mutation | Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| vg1208947655 | A -> G | LOC_Os12g15660-LOC_Os12g15670 | intergenic_region ; MODIFIER | silent_mutation | Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208947655 | NA | 5.10E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208947655 | NA | 2.18E-14 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208947655 | NA | 5.94E-25 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208947655 | NA | 9.70E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208947655 | 9.24E-07 | 2.59E-08 | mr1889_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208947655 | NA | 2.46E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208947655 | 2.03E-06 | 1.16E-08 | mr1907_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |