\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208526343:

Variant ID: vg1208526343 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8526343
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, T: 0.41, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AACATTGTGCACTGCTCTGTTGGTTGCGGCCAAATCGCCCTTCGATGCAGCCGAAGGTTGAAGCCTCTTGACAACGATCACGCCTGTCGGACCAGGCATC[A/T]
TGAGTTTGAGATAGTTATGGTGGGAGATGGCTTCGAACTTGTTCAAGGTTGCACAACCAAAAATGGCGTTGTAGTTGTATGGGATGTCGACGACGTCGAA

Reverse complement sequence

TTCGACGTCGTCGACATCCCATACAACTACAACGCCATTTTTGGTTGTGCAACCTTGAACAAGTTCGAAGCCATCTCCCACCATAACTATCTCAAACTCA[T/A]
GATGCCTGGTCCGACAGGCGTGATCGTTGTCAAGAGGCTTCAACCTTCGGCTGCATCGAAGGGCGATTTGGCCGCAACCAACAGAGCAGTGCACAATGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.10% 19.50% 1.14% 52.26% NA
All Indica  2759 14.00% 8.70% 1.45% 75.79% NA
All Japonica  1512 55.40% 40.30% 0.13% 4.10% NA
Aus  269 5.90% 6.70% 4.46% 82.90% NA
Indica I  595 22.90% 14.60% 3.36% 59.16% NA
Indica II  465 8.60% 12.30% 1.08% 78.06% NA
Indica III  913 11.30% 1.80% 0.22% 86.75% NA
Indica Intermediate  786 13.70% 10.30% 1.65% 74.30% NA
Temperate Japonica  767 30.80% 63.80% 0.26% 5.22% NA
Tropical Japonica  504 85.70% 10.90% 0.00% 3.37% NA
Japonica Intermediate  241 70.50% 27.40% 0.00% 2.07% NA
VI/Aromatic  96 8.30% 25.00% 0.00% 66.67% NA
Intermediate  90 35.60% 31.10% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208526343 A -> DEL LOC_Os12g14900.1 N frameshift_variant Average:12.596; most accessible tissue: Callus, score: 26.71 N N N N
vg1208526343 A -> T LOC_Os12g14900.1 missense_variant ; p.Met81Lys; MODERATE nonsynonymous_codon ; M81K Average:12.596; most accessible tissue: Callus, score: 26.71 benign -0.932 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208526343 NA 4.17E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208526343 NA 2.56E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208526343 NA 3.42E-11 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 4.97E-06 1.97E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 6.00E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 9.95E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 3.98E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 1.64E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 3.73E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 1.65E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 9.28E-12 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 2.81E-10 7.59E-21 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 5.78E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 1.03E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 2.46E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 1.70E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 1.64E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 4.76E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 8.15E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 2.85E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 8.99E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 4.68E-07 mr1466_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 9.74E-06 mr1497_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 3.68E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 5.35E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 1.86E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 9.05E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 1.51E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 8.60E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208526343 NA 3.76E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251