\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208306379:

Variant ID: vg1208306379 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8306379
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCATCATAATTATCATGCCGCTAAATTAATCACTAAAAAAATTACCACTGGACTGCCCCCAAAATCTTTTTTTATTTTTTTTATCTTTATCATTCTAG[C/T]
TCTGCTTGCAACCACATGTCAAAACTTGTGCCGCTTGATCCAACGTGCTGGGAAGGTGGAGAAAAGCGGCTGAGAGCTCGGTGCTTCAGCGTCGGAGCTC

Reverse complement sequence

GAGCTCCGACGCTGAAGCACCGAGCTCTCAGCCGCTTTTCTCCACCTTCCCAGCACGTTGGATCAAGCGGCACAAGTTTTGACATGTGGTTGCAAGCAGA[G/A]
CTAGAATGATAAAGATAAAAAAAATAAAAAAAGATTTTGGGGGCAGTCCAGTGGTAATTTTTTTAGTGATTAATTTAGCGGCATGATAATTATGATGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 29.50% 0.19% 20.29% NA
All Indica  2759 25.40% 48.50% 0.22% 25.92% NA
All Japonica  1512 95.70% 2.00% 0.20% 2.12% NA
Aus  269 33.80% 1.10% 0.00% 65.06% NA
Indica I  595 42.20% 34.50% 0.50% 22.86% NA
Indica II  465 24.70% 41.50% 0.22% 33.55% NA
Indica III  913 14.50% 59.70% 0.11% 25.74% NA
Indica Intermediate  786 25.80% 50.10% 0.13% 23.92% NA
Temperate Japonica  767 94.70% 1.40% 0.39% 3.52% NA
Tropical Japonica  504 96.00% 3.40% 0.00% 0.60% NA
Japonica Intermediate  241 98.30% 0.80% 0.00% 0.83% NA
VI/Aromatic  96 62.50% 6.20% 0.00% 31.25% NA
Intermediate  90 73.30% 18.90% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208306379 C -> DEL N N silent_mutation Average:39.255; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg1208306379 C -> T LOC_Os12g14550.1 upstream_gene_variant ; 16.0bp to feature; MODIFIER silent_mutation Average:39.255; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg1208306379 C -> T LOC_Os12g14540.1 downstream_gene_variant ; 4295.0bp to feature; MODIFIER silent_mutation Average:39.255; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg1208306379 C -> T LOC_Os12g14540-LOC_Os12g14550 intergenic_region ; MODIFIER silent_mutation Average:39.255; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208306379 NA 1.44E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208306379 4.96E-06 NA mr1397 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208306379 NA 5.14E-07 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208306379 NA 6.18E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208306379 NA 1.77E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251