| Variant ID: vg1208275876 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8275876 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 50. )
ACTTTATCGCTAGGTGCCTTCATCTCCATTGCTGGCTGACCTGACTGCTGCCGACTGGTTTCTTTACCTCCACGGTTGTGCAACTTCATTAGTTTTGATT[A/G]
GTATCATTATCTTCACTACCACCAATATTTTTGTCACCTCTGGTCTCTATCTTCACTTTTGATCGGTAGTATTATCTCTATATTGGTCGTCTTATCTCTA
TAGAGATAAGACGACCAATATAGAGATAATACTACCGATCAAAAGTGAAGATAGAGACCAGAGGTGACAAAAATATTGGTGGTAGTGAAGATAATGATAC[T/C]
AATCAAAACTAATGAAGTTGCACAACCGTGGAGGTAAAGAAACCAGTCGGCAGCAGTCAGGTCAGCCAGCAATGGAGATGAAGGCACCTAGCGATAAAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.20% | 17.90% | 0.74% | 53.09% | NA |
| All Indica | 2759 | 46.40% | 4.40% | 0.65% | 48.50% | NA |
| All Japonica | 1512 | 1.70% | 42.50% | 0.53% | 55.36% | NA |
| Aus | 269 | 2.20% | 13.80% | 2.60% | 81.41% | NA |
| Indica I | 595 | 30.80% | 8.10% | 1.01% | 60.17% | NA |
| Indica II | 465 | 39.80% | 6.00% | 0.65% | 53.55% | NA |
| Indica III | 913 | 59.30% | 0.80% | 0.00% | 39.98% | NA |
| Indica Intermediate | 786 | 47.30% | 5.00% | 1.15% | 46.56% | NA |
| Temperate Japonica | 767 | 0.70% | 67.00% | 0.13% | 32.20% | NA |
| Tropical Japonica | 504 | 3.80% | 12.10% | 0.79% | 83.33% | NA |
| Japonica Intermediate | 241 | 0.40% | 27.80% | 1.24% | 70.54% | NA |
| VI/Aromatic | 96 | 2.10% | 20.80% | 0.00% | 77.08% | NA |
| Intermediate | 90 | 22.20% | 30.00% | 2.22% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208275876 | A -> DEL | N | N | silent_mutation | Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg1208275876 | A -> G | LOC_Os12g14500.1 | upstream_gene_variant ; 2397.0bp to feature; MODIFIER | silent_mutation | Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg1208275876 | A -> G | LOC_Os12g14490.1 | downstream_gene_variant ; 1770.0bp to feature; MODIFIER | silent_mutation | Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg1208275876 | A -> G | LOC_Os12g14490-LOC_Os12g14500 | intergenic_region ; MODIFIER | silent_mutation | Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208275876 | NA | 2.44E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208275876 | NA | 1.66E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208275876 | NA | 5.05E-06 | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208275876 | NA | 2.52E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208275876 | NA | 2.18E-08 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208275876 | 3.68E-06 | NA | mr1338_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208275876 | NA | 6.73E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |