\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208275876:

Variant ID: vg1208275876 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8275876
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTATCGCTAGGTGCCTTCATCTCCATTGCTGGCTGACCTGACTGCTGCCGACTGGTTTCTTTACCTCCACGGTTGTGCAACTTCATTAGTTTTGATT[A/G]
GTATCATTATCTTCACTACCACCAATATTTTTGTCACCTCTGGTCTCTATCTTCACTTTTGATCGGTAGTATTATCTCTATATTGGTCGTCTTATCTCTA

Reverse complement sequence

TAGAGATAAGACGACCAATATAGAGATAATACTACCGATCAAAAGTGAAGATAGAGACCAGAGGTGACAAAAATATTGGTGGTAGTGAAGATAATGATAC[T/C]
AATCAAAACTAATGAAGTTGCACAACCGTGGAGGTAAAGAAACCAGTCGGCAGCAGTCAGGTCAGCCAGCAATGGAGATGAAGGCACCTAGCGATAAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.20% 17.90% 0.74% 53.09% NA
All Indica  2759 46.40% 4.40% 0.65% 48.50% NA
All Japonica  1512 1.70% 42.50% 0.53% 55.36% NA
Aus  269 2.20% 13.80% 2.60% 81.41% NA
Indica I  595 30.80% 8.10% 1.01% 60.17% NA
Indica II  465 39.80% 6.00% 0.65% 53.55% NA
Indica III  913 59.30% 0.80% 0.00% 39.98% NA
Indica Intermediate  786 47.30% 5.00% 1.15% 46.56% NA
Temperate Japonica  767 0.70% 67.00% 0.13% 32.20% NA
Tropical Japonica  504 3.80% 12.10% 0.79% 83.33% NA
Japonica Intermediate  241 0.40% 27.80% 1.24% 70.54% NA
VI/Aromatic  96 2.10% 20.80% 0.00% 77.08% NA
Intermediate  90 22.20% 30.00% 2.22% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208275876 A -> DEL N N silent_mutation Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg1208275876 A -> G LOC_Os12g14500.1 upstream_gene_variant ; 2397.0bp to feature; MODIFIER silent_mutation Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg1208275876 A -> G LOC_Os12g14490.1 downstream_gene_variant ; 1770.0bp to feature; MODIFIER silent_mutation Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg1208275876 A -> G LOC_Os12g14490-LOC_Os12g14500 intergenic_region ; MODIFIER silent_mutation Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208275876 NA 2.44E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876 NA 1.66E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876 NA 5.05E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876 NA 2.52E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876 NA 2.18E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876 3.68E-06 NA mr1338_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876 NA 6.73E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251