Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1208275876:

Variant ID: vg1208275876 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8275876
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTTATCGCTAGGTGCCTTCATCTCCATTGCTGGCTGACCTGACTGCTGCCGACTGGTTTCTTTACCTCCACGGTTGTGCAACTTCATTAGTTTTGATT[A/G]
GTATCATTATCTTCACTACCACCAATATTTTTGTCACCTCTGGTCTCTATCTTCACTTTTGATCGGTAGTATTATCTCTATATTGGTCGTCTTATCTCTA

Reverse complement sequence

TAGAGATAAGACGACCAATATAGAGATAATACTACCGATCAAAAGTGAAGATAGAGACCAGAGGTGACAAAAATATTGGTGGTAGTGAAGATAATGATAC[T/C]
AATCAAAACTAATGAAGTTGCACAACCGTGGAGGTAAAGAAACCAGTCGGCAGCAGTCAGGTCAGCCAGCAATGGAGATGAAGGCACCTAGCGATAAAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.20%	17.90%	0.74%	53.09%	NA
All Indica	2759	46.40%	4.40%	0.65%	48.50%	NA
All Japonica	1512	1.70%	42.50%	0.53%	55.36%	NA
Aus	269	2.20%	13.80%	2.60%	81.41%	NA
Indica I	595	30.80%	8.10%	1.01%	60.17%	NA
Indica II	465	39.80%	6.00%	0.65%	53.55%	NA
Indica III	913	59.30%	0.80%	0.00%	39.98%	NA
Indica Intermediate	786	47.30%	5.00%	1.15%	46.56%	NA
Temperate Japonica	767	0.70%	67.00%	0.13%	32.20%	NA
Tropical Japonica	504	3.80%	12.10%	0.79%	83.33%	NA
Japonica Intermediate	241	0.40%	27.80%	1.24%	70.54%	NA
VI/Aromatic	96	2.10%	20.80%	0.00%	77.08%	NA
Intermediate	90	22.20%	30.00%	2.22%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208275876	A -> DEL	N	N	silent_mutation	Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg1208275876	A -> G	LOC_Os12g14500.1	upstream_gene_variant ; 2397.0bp to feature; MODIFIER	silent_mutation	Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg1208275876	A -> G	LOC_Os12g14490.1	downstream_gene_variant ; 1770.0bp to feature; MODIFIER	silent_mutation	Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg1208275876	A -> G	LOC_Os12g14490-LOC_Os12g14500	intergenic_region ; MODIFIER	silent_mutation	Average:24.839; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208275876	NA	2.44E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876	NA	1.66E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876	NA	5.05E-06	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876	NA	2.52E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876	NA	2.18E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876	3.68E-06	NA	mr1338_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208275876	NA	6.73E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251