\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208269194:

Variant ID: vg1208269194 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8269194
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCACGCTACCATGTCCTAGGCCCACCTTGCTGGTGGTAAGGTAGTTACTGCATCTATGCGTGGATGGGGAGCTCGTGCTGGTGGAAGGCGACCATCACT[G/A]
AAGCTAGCGATCATGAGTCGTTGCATGAGAAGCTCCCGTGGAGCCGGCGCATCACCACCTGCTTCTCCAGCTTCCACCTCAGATGAGGGATCCGGCGCCG

Reverse complement sequence

CGGCGCCGGATCCCTCATCTGAGGTGGAAGCTGGAGAAGCAGGTGGTGATGCGCCGGCTCCACGGGAGCTTCTCATGCAACGACTCATGATCGCTAGCTT[C/T]
AGTGATGGTCGCCTTCCACCAGCACGAGCTCCCCATCCACGCATAGATGCAGTAACTACCTTACCACCAGCAAGGTGGGCCTAGGACATGGTAGCGTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 21.30% 0.99% 24.59% NA
All Indica  2759 62.20% 2.20% 1.45% 34.14% NA
All Japonica  1512 43.50% 53.20% 0.26% 3.04% NA
Aus  269 19.70% 30.90% 0.37% 49.07% NA
Indica I  595 56.80% 1.00% 1.01% 41.18% NA
Indica II  465 52.00% 2.20% 3.01% 42.80% NA
Indica III  913 69.80% 2.20% 0.88% 27.16% NA
Indica Intermediate  786 63.60% 3.10% 1.53% 31.81% NA
Temperate Japonica  767 67.90% 27.00% 0.52% 4.56% NA
Tropical Japonica  504 14.10% 84.70% 0.00% 1.19% NA
Japonica Intermediate  241 27.40% 70.50% 0.00% 2.07% NA
VI/Aromatic  96 29.20% 33.30% 2.08% 35.42% NA
Intermediate  90 57.80% 33.30% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208269194 G -> DEL N N silent_mutation Average:54.67; most accessible tissue: Minghui63 flag leaf, score: 84.42 N N N N
vg1208269194 G -> A LOC_Os12g14490.1 upstream_gene_variant ; 2772.0bp to feature; MODIFIER silent_mutation Average:54.67; most accessible tissue: Minghui63 flag leaf, score: 84.42 N N N N
vg1208269194 G -> A LOC_Os12g14480.1 intron_variant ; MODIFIER silent_mutation Average:54.67; most accessible tissue: Minghui63 flag leaf, score: 84.42 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208269194 NA 3.09E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208269194 3.89E-07 7.06E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 1.18E-06 5.11E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.17E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.19E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 2.92E-07 7.78E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 1.41E-09 2.11E-20 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.33E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 3.51E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 7.49E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 4.28E-10 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.95E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.04E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.45E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 3.34E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 4.27E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 4.99E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 8.35E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 7.66E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 3.11E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.48E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 7.01E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 8.72E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 5.73E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.51E-11 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.88E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.08E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 5.92E-10 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.03E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 9.18E-11 mr1527_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 3.72E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 2.41E-09 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.17E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 4.33E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 5.21E-14 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 9.95E-07 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.18E-18 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 5.37E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 2.53E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 6.30E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 4.35E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 5.90E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.65E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 1.03E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208269194 NA 3.02E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251