Variant ID: vg1208123893 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 8123893 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTTGATAAAGTGCCGGGTGATCTGTTTTCCTTGAAGGCCCTGATCTTTCAGCTTAATCATCCTCTCGATCAGTTCTACTGCTTGTGCAGCTTCGTCTCCC[A/G]
TTGGCAGTGAATTCCAAGTATCCCGATAAACTGGAGGAAGACAGGAGTACTCGGGAAGAACAGGCTCGGGGTTTTGAACATAAAACCAATTTGCGTGCCA
TGGCACGCAAATTGGTTTTATGTTCAAAACCCCGAGCCTGTTCTTCCCGAGTACTCCTGTCTTCCTCCAGTTTATCGGGATACTTGGAATTCACTGCCAA[T/C]
GGGAGACGAAGCTGCACAAGCAGTAGAACTGATCGAGAGGATGATTAAGCTGAAAGATCAGGGCCTTCAAGGAAAACAGATCACCCGGCACTTTATCAAG
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 44.80% | 10.20% | 22.18% | 22.79% | NA |
All Indica | 2759 | 36.60% | 16.80% | 35.56% | 11.02% | NA |
All Japonica | 1512 | 46.80% | 0.50% | 3.17% | 49.47% | NA |
Aus | 269 | 97.00% | 0.40% | 1.86% | 0.74% | NA |
Indica I | 595 | 50.30% | 7.20% | 32.94% | 9.58% | NA |
Indica II | 465 | 47.30% | 18.30% | 27.31% | 7.10% | NA |
Indica III | 913 | 22.30% | 19.90% | 42.72% | 15.01% | NA |
Indica Intermediate | 786 | 36.50% | 19.60% | 34.10% | 9.80% | NA |
Temperate Japonica | 767 | 73.70% | 0.00% | 1.96% | 24.38% | NA |
Tropical Japonica | 504 | 13.50% | 1.60% | 5.95% | 78.97% | NA |
Japonica Intermediate | 241 | 31.10% | 0.00% | 1.24% | 67.63% | NA |
VI/Aromatic | 96 | 91.70% | 0.00% | 2.08% | 6.25% | NA |
Intermediate | 90 | 56.70% | 11.10% | 13.33% | 18.89% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1208123893 | A -> DEL | LOC_Os12g14270.1 | N | frameshift_variant | Average:25.089; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
vg1208123893 | A -> G | LOC_Os12g14270.1 | missense_variant ; p.Met194Thr; MODERATE | nonsynonymous_codon ; M194T | Average:25.089; most accessible tissue: Minghui63 young leaf, score: 38.036 | unknown | unknown | TOLERATED | 0.10 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1208123893 | NA | 6.50E-10 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208123893 | NA | 9.24E-08 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208123893 | 6.84E-06 | NA | mr1539_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208123893 | 4.43E-06 | 9.47E-09 | mr1539_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208123893 | 4.59E-07 | NA | mr1540_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208123893 | 5.24E-07 | 3.51E-10 | mr1540_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208123893 | NA | 8.91E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208123893 | 3.11E-06 | NA | mr1732_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208123893 | 3.26E-06 | 5.94E-09 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208123893 | NA | 5.39E-07 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |