\
| Variant ID: vg1207943829 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7943829 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 96. )
TGTTGGGACGAGGCTCATGTGTTGGGCAGTCGCGGAGCGCGGGTAAAGTGTACATCCACTGCAGTGTGAGTAAAACAAATCTATTCGAATAGCCGTGCTC[G/A]
CGGTTATTGAGCACCGGAACATGTATTACACTTGGGTAGACTCTAAATTCTTAACTTGTGTGGGATGGGTTATTGCATGATGATTTTTATGCTGTTGGAG
CTCCAACAGCATAAAAATCATCATGCAATAACCCATCCCACACAAGTTAAGAATTTAGAGTCTACCCAAGTGTAATACATGTTCCGGTGCTCAATAACCG[C/T]
GAGCACGGCTATTCGAATAGATTTGTTTTACTCACACTGCAGTGGATGTACACTTTACCCGCGCTCCGCGACTGCCCAACACATGAGCCTCGTCCCAACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.30% | 17.00% | 0.91% | 25.77% | NA |
| All Indica | 2759 | 83.70% | 3.00% | 0.72% | 12.61% | NA |
| All Japonica | 1512 | 6.10% | 43.80% | 0.93% | 49.21% | NA |
| Aus | 269 | 67.70% | 3.70% | 1.49% | 27.14% | NA |
| Indica I | 595 | 79.00% | 3.70% | 0.34% | 16.97% | NA |
| Indica II | 465 | 88.80% | 5.20% | 0.43% | 5.59% | NA |
| Indica III | 913 | 87.20% | 0.70% | 0.77% | 11.39% | NA |
| Indica Intermediate | 786 | 80.20% | 3.80% | 1.15% | 14.89% | NA |
| Temperate Japonica | 767 | 7.00% | 68.60% | 0.65% | 23.73% | NA |
| Tropical Japonica | 504 | 5.80% | 12.70% | 1.59% | 79.96% | NA |
| Japonica Intermediate | 241 | 3.70% | 29.90% | 0.41% | 65.98% | NA |
| VI/Aromatic | 96 | 46.90% | 21.90% | 1.04% | 30.21% | NA |
| Intermediate | 90 | 36.70% | 32.20% | 4.44% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207943829 | G -> DEL | N | N | silent_mutation | Average:65.036; most accessible tissue: Minghui63 flag leaf, score: 85.67 | N | N | N | N |
| vg1207943829 | G -> A | LOC_Os12g13980.1 | upstream_gene_variant ; 1973.0bp to feature; MODIFIER | silent_mutation | Average:65.036; most accessible tissue: Minghui63 flag leaf, score: 85.67 | N | N | N | N |
| vg1207943829 | G -> A | LOC_Os12g13980-LOC_Os12g13990 | intergenic_region ; MODIFIER | silent_mutation | Average:65.036; most accessible tissue: Minghui63 flag leaf, score: 85.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207943829 | NA | 2.40E-07 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 2.60E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 4.43E-07 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 5.61E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 2.46E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 3.05E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 7.22E-06 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | 3.67E-06 | NA | mr1494_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 6.31E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 3.01E-09 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 1.60E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 1.35E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207943829 | NA | 8.92E-14 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |