\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207772422:

Variant ID: vg1207772422 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7772422
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CTATCTCCATTGATGATCATAAAACAAACTAGATATCACAATTATAGATAAAACTTAATAGATCGAACTCAACCGATGCAGCATTAAGCATAAAGATAAC[C/T]
GTAAGATCTAAACAAGTCGATAAAAACCTCTGAGAGATGGTAGAAATACAATACAATCTAAATTAATAATGAGATCTAACTCTATCGGCTACTTTCTAAT

Reverse complement sequence

ATTAGAAAGTAGCCGATAGAGTTAGATCTCATTATTAATTTAGATTGTATTGTATTTCTACCATCTCTCAGAGGTTTTTATCGACTTGTTTAGATCTTAC[G/A]
GTTATCTTTATGCTTAATGCTGCATCGGTTGAGTTCGATCTATTAAGTTTTATCTATAATTGTGATATCTAGTTTGTTTTATGATCATCAATGGAGATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 0.80% 5.37% 55.40% NA
All Indica  2759 10.90% 0.00% 3.37% 85.72% NA
All Japonica  1512 92.80% 2.30% 0.60% 4.30% NA
Aus  269 7.80% 0.00% 44.98% 47.21% NA
Indica I  595 7.10% 0.00% 1.85% 91.09% NA
Indica II  465 8.80% 0.00% 1.51% 89.68% NA
Indica III  913 10.10% 0.00% 3.29% 86.64% NA
Indica Intermediate  786 16.00% 0.00% 5.73% 78.24% NA
Temperate Japonica  767 92.00% 1.70% 0.91% 5.35% NA
Tropical Japonica  504 96.00% 0.00% 0.00% 3.97% NA
Japonica Intermediate  241 88.40% 9.10% 0.83% 1.66% NA
VI/Aromatic  96 34.40% 1.00% 28.12% 36.46% NA
Intermediate  90 66.70% 0.00% 4.44% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207772422 C -> DEL N N silent_mutation Average:12.81; most accessible tissue: Callus, score: 24.346 N N N N
vg1207772422 C -> T LOC_Os12g13770.1 downstream_gene_variant ; 4697.0bp to feature; MODIFIER silent_mutation Average:12.81; most accessible tissue: Callus, score: 24.346 N N N N
vg1207772422 C -> T LOC_Os12g13760-LOC_Os12g13770 intergenic_region ; MODIFIER silent_mutation Average:12.81; most accessible tissue: Callus, score: 24.346 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207772422 NA 7.97E-14 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 1.18E-12 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 6.02E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 6.65E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 1.32E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 5.60E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 8.46E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 1.87E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 3.95E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 1.62E-17 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 2.64E-06 NA mr1565 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 1.74E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 4.50E-09 3.76E-31 mr1024_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 1.09E-06 1.09E-06 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 4.63E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 7.55E-18 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 2.17E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 1.43E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 5.75E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 8.10E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 7.87E-10 NA mr1565_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 1.14E-07 2.59E-09 mr1565_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 1.04E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 7.16E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 9.71E-06 NA mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 1.36E-06 5.31E-23 mr1922_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 6.09E-06 NA mr1930_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 8.12E-07 8.12E-07 mr1930_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 NA 5.05E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207772422 2.25E-07 2.26E-07 mr1940_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251