\
| Variant ID: vg1207089520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7089520 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TATTATGTTGTTCGATCTCATGTAAATAGCGTTAATAATTAGTACAGATAATTTTGACAACATAAATTATTCCTTCGTATATTACCCATAAACATGCATA[G/C]
GTGAATTAGATATATAATATAAGAAAAACAATCAAAGCCCATATTATGTTTGCGAAAGATGGTGATTGGCAAGTTTACATATAACTGAGACAAAGTGATT
AATCACTTTGTCTCAGTTATATGTAAACTTGCCAATCACCATCTTTCGCAAACATAATATGGGCTTTGATTGTTTTTCTTATATTATATATCTAATTCAC[C/G]
TATGCATGTTTATGGGTAATATACGAAGGAATAATTTATGTTGTCAAAATTATCTGTACTAATTATTAACGCTATTTACATGAGATCGAACAACATAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.00% | 4.30% | 1.04% | 12.61% | NA |
| All Indica | 2759 | 99.10% | 0.30% | 0.11% | 0.54% | NA |
| All Japonica | 1512 | 50.20% | 11.60% | 1.59% | 36.57% | NA |
| Aus | 269 | 85.10% | 5.20% | 7.43% | 2.23% | NA |
| Indica I | 595 | 99.30% | 0.00% | 0.17% | 0.50% | NA |
| Indica II | 465 | 98.30% | 0.40% | 0.00% | 1.29% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 98.70% | 0.50% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 44.60% | 1.00% | 2.22% | 52.15% | NA |
| Tropical Japonica | 504 | 53.20% | 30.00% | 0.79% | 16.07% | NA |
| Japonica Intermediate | 241 | 61.80% | 7.10% | 1.24% | 29.88% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 71.10% | 8.90% | 2.22% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207089520 | G -> C | LOC_Os12g12840-LOC_Os12g12850 | intergenic_region ; MODIFIER | silent_mutation | Average:60.073; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg1207089520 | G -> DEL | N | N | silent_mutation | Average:60.073; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207089520 | NA | 7.80E-07 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 8.79E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 2.38E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 1.15E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 4.68E-06 | mr1633 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 1.66E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 1.09E-06 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 2.17E-06 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | 9.70E-07 | NA | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | 2.82E-06 | NA | mr1960 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 4.10E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 8.61E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | 4.70E-06 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 9.62E-09 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 7.52E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 2.39E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207089520 | NA | 3.70E-07 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |