\
| Variant ID: vg1207087706 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 7087706 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 119. )
TCTAGCTAATAATTTAAATTTAAAAAAAAATATTATAAAGGAAAAAATTTAATCCTTAATGTCAATTTAAATCGGTAGATCCATAATATTAAACCGATGA[A/G]
CCCATTAAATCCACATATATGCACCACTGACTTTTGCCATTTGTGTGACAACCAAATAACAACGAAACAACATAGTAATAAATAATAACACACATATAAG
CTTATATGTGTGTTATTATTTATTACTATGTTGTTTCGTTGTTATTTGGTTGTCACACAAATGGCAAAAGTCAGTGGTGCATATATGTGGATTTAATGGG[T/C]
TCATCGGTTTAATATTATGGATCTACCGATTTAAATTGACATTAAGGATTAAATTTTTTCCTTTATAATATTTTTTTTTAAATTTAAATTATTAGCTAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 8.90% | 1.69% | 14.75% | NA |
| All Indica | 2759 | 97.40% | 0.50% | 1.09% | 1.01% | NA |
| All Japonica | 1512 | 34.70% | 23.70% | 2.12% | 39.48% | NA |
| Aus | 269 | 68.80% | 13.80% | 5.20% | 12.27% | NA |
| Indica I | 595 | 99.00% | 0.30% | 0.00% | 0.67% | NA |
| Indica II | 465 | 93.50% | 0.40% | 4.52% | 1.51% | NA |
| Indica III | 913 | 98.80% | 0.40% | 0.33% | 0.44% | NA |
| Indica Intermediate | 786 | 96.70% | 0.90% | 0.76% | 1.65% | NA |
| Temperate Japonica | 767 | 40.70% | 2.50% | 1.43% | 55.41% | NA |
| Tropical Japonica | 504 | 16.90% | 61.90% | 2.98% | 18.25% | NA |
| Japonica Intermediate | 241 | 52.70% | 11.60% | 2.49% | 33.20% | NA |
| VI/Aromatic | 96 | 79.20% | 0.00% | 3.12% | 17.71% | NA |
| Intermediate | 90 | 62.20% | 12.20% | 1.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1207087706 | A -> DEL | N | N | silent_mutation | Average:31.706; most accessible tissue: Minghui63 flower, score: 46.748 | N | N | N | N |
| vg1207087706 | A -> G | LOC_Os12g12840-LOC_Os12g12850 | intergenic_region ; MODIFIER | silent_mutation | Average:31.706; most accessible tissue: Minghui63 flower, score: 46.748 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1207087706 | 6.06E-06 | NA | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 2.33E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 1.31E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 2.55E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 8.19E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | 4.68E-06 | 9.42E-07 | mr1417 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 1.74E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 9.21E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 2.58E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 1.18E-07 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 7.09E-06 | mr1876 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | 3.08E-06 | NA | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | 2.04E-07 | NA | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1207087706 | NA | 9.22E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |