Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1206797869:

Variant ID: vg1206797869 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6797869
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCGATCGGTTTTTTTCCTTTATTTTTTTTTCTTTTTGGTTACTGACTGTGACACGGGCGATCGCTGCTAAGTGGACTCTCGTTTTGTTGCTAACGAGAG[A/C]
CCTCTGTCCCGATTCTTCCTTAGCAAATAGAAAATATATTCTTACCTTCTATACTTTAAATAAATTTTTCTCTTAAATCACTCATCCGATATACGATATG

Reverse complement sequence

CATATCGTATATCGGATGAGTGATTTAAGAGAAAAATTTATTTAAAGTATAGAAGGTAAGAATATATTTTCTATTTGCTAAGGAAGAATCGGGACAGAGG[T/G]
CTCTCGTTAGCAACAAAACGAGAGTCCACTTAGCAGCGATCGCCCGTGTCACAGTCAGTAACCAAAAAGAAAAAAAAATAAAGGAAAAAAACCGATCGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	36.40%	0.04%	0.00%	NA
All Indica	2759	96.00%	4.00%	0.07%	0.00%	NA
All Japonica	1512	4.40%	95.60%	0.00%	0.00%	NA
Aus	269	70.60%	29.40%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	96.40%	3.60%	0.00%	0.00%	NA
Indica Intermediate	786	93.60%	6.10%	0.25%	0.00%	NA
Temperate Japonica	767	5.30%	94.70%	0.00%	0.00%	NA
Tropical Japonica	504	4.00%	96.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	42.20%	57.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206797869	A -> C	LOC_Os12g12350.1	downstream_gene_variant ; 3576.0bp to feature; MODIFIER	silent_mutation	Average:82.689; most accessible tissue: Zhenshan97 flower, score: 89.987	N	N	N	N
vg1206797869	A -> C	LOC_Os12g12360.1	downstream_gene_variant ; 1327.0bp to feature; MODIFIER	silent_mutation	Average:82.689; most accessible tissue: Zhenshan97 flower, score: 89.987	N	N	N	N
vg1206797869	A -> C	LOC_Os12g12360.2	downstream_gene_variant ; 3251.0bp to feature; MODIFIER	silent_mutation	Average:82.689; most accessible tissue: Zhenshan97 flower, score: 89.987	N	N	N	N
vg1206797869	A -> C	LOC_Os12g12350-LOC_Os12g12360	intergenic_region ; MODIFIER	silent_mutation	Average:82.689; most accessible tissue: Zhenshan97 flower, score: 89.987	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1206797869	A	C	-0.01	0.01	0.01	0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206797869	NA	9.51E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206797869	3.01E-06	3.85E-13	mr1270	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206797869	NA	2.50E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206797869	NA	1.96E-14	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206797869	NA	3.31E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206797869	NA	5.98E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206797869	NA	3.86E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206797869	NA	2.56E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251