\
| Variant ID: vg1206433093 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6433093 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 78. )
AACAGACATAATGGTTGCACTCCCAGGGCTCACTACTACAAATATGATTTTTCCAAAGATCCAGGTATTATATTGATGGCAATGGGGTGTCCGATTTTCC[G/A]
TCAGGTGAAGATAATTATCGATCTGGAGAAAACTTGACACACACGATCTGCAAAATCCGAACCCTTCAATCGCAGCACTACGTCTTTTTTGGTTATCAAC
GTTGATAACCAAAAAAGACGTAGTGCTGCGATTGAAGGGTTCGGATTTTGCAGATCGTGTGTGTCAAGTTTTCTCCAGATCGATAATTATCTTCACCTGA[C/T]
GGAAAATCGGACACCCCATTGCCATCAATATAATACCTGGATCTTTGGAAAAATCATATTTGTAGTAGTGAGCCCTGGGAGTGCAACCATTATGTCTGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.50% | 15.90% | 0.32% | 58.32% | NA |
| All Indica | 2759 | 36.90% | 7.20% | 0.40% | 55.49% | NA |
| All Japonica | 1512 | 5.80% | 30.70% | 0.20% | 63.36% | NA |
| Aus | 269 | 1.50% | 21.90% | 0.37% | 76.21% | NA |
| Indica I | 595 | 86.70% | 4.20% | 0.00% | 9.08% | NA |
| Indica II | 465 | 20.60% | 18.10% | 1.08% | 60.22% | NA |
| Indica III | 913 | 11.40% | 2.70% | 0.33% | 85.54% | NA |
| Indica Intermediate | 786 | 38.30% | 8.40% | 0.38% | 52.93% | NA |
| Temperate Japonica | 767 | 9.00% | 40.00% | 0.39% | 50.59% | NA |
| Tropical Japonica | 504 | 2.20% | 10.50% | 0.00% | 87.30% | NA |
| Japonica Intermediate | 241 | 2.90% | 43.20% | 0.00% | 53.94% | NA |
| VI/Aromatic | 96 | 69.80% | 10.40% | 0.00% | 19.79% | NA |
| Intermediate | 90 | 33.30% | 18.90% | 0.00% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206433093 | G -> DEL | N | N | silent_mutation | Average:45.577; most accessible tissue: Zhenshan97 flower, score: 70.756 | N | N | N | N |
| vg1206433093 | G -> A | LOC_Os12g11840.1 | downstream_gene_variant ; 3301.0bp to feature; MODIFIER | silent_mutation | Average:45.577; most accessible tissue: Zhenshan97 flower, score: 70.756 | N | N | N | N |
| vg1206433093 | G -> A | LOC_Os12g11840-LOC_Os12g11860 | intergenic_region ; MODIFIER | silent_mutation | Average:45.577; most accessible tissue: Zhenshan97 flower, score: 70.756 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206433093 | 4.54E-06 | NA | mr1177 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | 7.55E-07 | 7.55E-07 | mr1381 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | NA | 2.41E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | NA | 6.94E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | NA | 5.11E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | NA | 2.84E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | NA | 1.85E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | NA | 2.27E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | 1.14E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | NA | 5.48E-06 | mr1652_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | NA | 6.51E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | NA | 1.37E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206433093 | 5.51E-06 | 1.12E-06 | mr1923_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |