\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206398354:

Variant ID: vg1206398354 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6398354
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCGTTTAGTTTCTGTGATATGAACCCTTAAAAATATATTCCTTAGAAATAAAAAAGTTCTAAAAAAAGGAAAATGGACCATGTTGGCATGCTATTGC[G/A]
CACCAGGCTCATGAAAGTGCGCGTGACCCGGCAGTACTGCAGCGAGCCAAGATTGAGGCCGGCCCAACGTGGAATCGAATCGATCTGAGCCATTCGTTTT

Reverse complement sequence

AAAACGAATGGCTCAGATCGATTCGATTCCACGTTGGGCCGGCCTCAATCTTGGCTCGCTGCAGTACTGCCGGGTCACGCGCACTTTCATGAGCCTGGTG[C/T]
GCAATAGCATGCCAACATGGTCCATTTTCCTTTTTTTAGAACTTTTTTATTTCTAAGGAATATATTTTTAAGGGTTCATATCACAGAAACTAAACGGAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.50% 16.00% 0.17% 59.31% NA
All Indica  2759 35.20% 3.60% 0.14% 61.04% NA
All Japonica  1512 5.60% 38.30% 0.20% 55.89% NA
Aus  269 2.20% 18.20% 0.37% 79.18% NA
Indica I  595 85.70% 6.10% 0.00% 8.24% NA
Indica II  465 18.70% 2.20% 0.00% 79.14% NA
Indica III  913 10.80% 2.40% 0.11% 86.64% NA
Indica Intermediate  786 35.10% 3.90% 0.38% 60.56% NA
Temperate Japonica  767 9.60% 45.00% 0.00% 45.37% NA
Tropical Japonica  504 1.00% 22.20% 0.40% 76.39% NA
Japonica Intermediate  241 2.50% 50.60% 0.41% 46.47% NA
VI/Aromatic  96 68.80% 10.40% 0.00% 20.83% NA
Intermediate  90 32.20% 22.20% 0.00% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206398354 G -> DEL N N silent_mutation Average:67.365; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1206398354 G -> A LOC_Os12g11790.1 upstream_gene_variant ; 4100.0bp to feature; MODIFIER silent_mutation Average:67.365; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1206398354 G -> A LOC_Os12g11800.1 upstream_gene_variant ; 1932.0bp to feature; MODIFIER silent_mutation Average:67.365; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1206398354 G -> A LOC_Os12g11790-LOC_Os12g11800 intergenic_region ; MODIFIER silent_mutation Average:67.365; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206398354 NA 9.64E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398354 NA 4.52E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398354 NA 5.89E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398354 8.01E-07 NA mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398354 NA 1.01E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398354 5.85E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398354 8.24E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206398354 NA 1.46E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251