| Variant ID: vg1206398354 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6398354 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 70. )
ATTCCGTTTAGTTTCTGTGATATGAACCCTTAAAAATATATTCCTTAGAAATAAAAAAGTTCTAAAAAAAGGAAAATGGACCATGTTGGCATGCTATTGC[G/A]
CACCAGGCTCATGAAAGTGCGCGTGACCCGGCAGTACTGCAGCGAGCCAAGATTGAGGCCGGCCCAACGTGGAATCGAATCGATCTGAGCCATTCGTTTT
AAAACGAATGGCTCAGATCGATTCGATTCCACGTTGGGCCGGCCTCAATCTTGGCTCGCTGCAGTACTGCCGGGTCACGCGCACTTTCATGAGCCTGGTG[C/T]
GCAATAGCATGCCAACATGGTCCATTTTCCTTTTTTTAGAACTTTTTTATTTCTAAGGAATATATTTTTAAGGGTTCATATCACAGAAACTAAACGGAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.50% | 16.00% | 0.17% | 59.31% | NA |
| All Indica | 2759 | 35.20% | 3.60% | 0.14% | 61.04% | NA |
| All Japonica | 1512 | 5.60% | 38.30% | 0.20% | 55.89% | NA |
| Aus | 269 | 2.20% | 18.20% | 0.37% | 79.18% | NA |
| Indica I | 595 | 85.70% | 6.10% | 0.00% | 8.24% | NA |
| Indica II | 465 | 18.70% | 2.20% | 0.00% | 79.14% | NA |
| Indica III | 913 | 10.80% | 2.40% | 0.11% | 86.64% | NA |
| Indica Intermediate | 786 | 35.10% | 3.90% | 0.38% | 60.56% | NA |
| Temperate Japonica | 767 | 9.60% | 45.00% | 0.00% | 45.37% | NA |
| Tropical Japonica | 504 | 1.00% | 22.20% | 0.40% | 76.39% | NA |
| Japonica Intermediate | 241 | 2.50% | 50.60% | 0.41% | 46.47% | NA |
| VI/Aromatic | 96 | 68.80% | 10.40% | 0.00% | 20.83% | NA |
| Intermediate | 90 | 32.20% | 22.20% | 0.00% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206398354 | G -> DEL | N | N | silent_mutation | Average:67.365; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1206398354 | G -> A | LOC_Os12g11790.1 | upstream_gene_variant ; 4100.0bp to feature; MODIFIER | silent_mutation | Average:67.365; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1206398354 | G -> A | LOC_Os12g11800.1 | upstream_gene_variant ; 1932.0bp to feature; MODIFIER | silent_mutation | Average:67.365; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1206398354 | G -> A | LOC_Os12g11790-LOC_Os12g11800 | intergenic_region ; MODIFIER | silent_mutation | Average:67.365; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206398354 | NA | 9.64E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206398354 | NA | 4.52E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206398354 | NA | 5.89E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206398354 | 8.01E-07 | NA | mr1549_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206398354 | NA | 1.01E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206398354 | 5.85E-06 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206398354 | 8.24E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206398354 | NA | 1.46E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |