Variant ID: vg1206394368 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 6394368 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, T: 0.16, others allele: 0.00, population size: 70. )
AGAGAAGAGAGTGAGAGAAAGATAATGATAAGAGATTGAAGGCAGGGAGGTAGCAGGTAGGAGGTGGATAAGATTGAAGGAAGGGTATTTTGGTCAAATT[G/T]
GAATAATATATAGATTTTTTCCTTTTTCCTAAATGAAACCCTAATGGTGTAGTTCAAATAGGGACAAACGATAGGTTCGATTTTAAATTGGTCAAATAAG
CTTATTTGACCAATTTAAAATCGAACCTATCGTTTGTCCCTATTTGAACTACACCATTAGGGTTTCATTTAGGAAAAAGGAAAAAATCTATATATTATTC[C/A]
AATTTGACCAAAATACCCTTCCTTCAATCTTATCCACCTCCTACCTGCTACCTCCCTGCCTTCAATCTCTTATCATTATCTTTCTCTCACTCTCTTCTCT
Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 24.70% | 15.80% | 0.23% | 59.20% | NA |
All Indica | 2759 | 35.40% | 3.40% | 0.14% | 61.00% | NA |
All Japonica | 1512 | 5.70% | 38.20% | 0.26% | 55.82% | NA |
Aus | 269 | 3.00% | 17.80% | 0.74% | 78.44% | NA |
Indica I | 595 | 85.70% | 6.10% | 0.00% | 8.24% | NA |
Indica II | 465 | 19.10% | 2.40% | 0.00% | 78.49% | NA |
Indica III | 913 | 11.00% | 2.10% | 0.22% | 86.75% | NA |
Indica Intermediate | 786 | 35.40% | 3.70% | 0.25% | 60.69% | NA |
Temperate Japonica | 767 | 9.80% | 44.50% | 0.26% | 45.50% | NA |
Tropical Japonica | 504 | 1.00% | 22.60% | 0.20% | 76.19% | NA |
Japonica Intermediate | 241 | 2.50% | 51.00% | 0.41% | 46.06% | NA |
VI/Aromatic | 96 | 68.80% | 10.40% | 0.00% | 20.83% | NA |
Intermediate | 90 | 35.60% | 18.90% | 1.11% | 44.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1206394368 | G -> DEL | N | N | silent_mutation | Average:65.393; most accessible tissue: Callus, score: 93.722 | N | N | N | N |
vg1206394368 | G -> T | LOC_Os12g11780.1 | upstream_gene_variant ; 2424.0bp to feature; MODIFIER | silent_mutation | Average:65.393; most accessible tissue: Callus, score: 93.722 | N | N | N | N |
vg1206394368 | G -> T | LOC_Os12g11790.1 | upstream_gene_variant ; 114.0bp to feature; MODIFIER | silent_mutation | Average:65.393; most accessible tissue: Callus, score: 93.722 | N | N | N | N |
vg1206394368 | G -> T | LOC_Os12g11790-LOC_Os12g11800 | intergenic_region ; MODIFIER | silent_mutation | Average:65.393; most accessible tissue: Callus, score: 93.722 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1206394368 | NA | 1.73E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1206394368 | 5.37E-07 | 1.16E-08 | mr1691_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1206394368 | 5.44E-07 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1206394368 | NA | 4.46E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |