\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206394368:

Variant ID: vg1206394368 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6394368
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, T: 0.16, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGAAGAGAGTGAGAGAAAGATAATGATAAGAGATTGAAGGCAGGGAGGTAGCAGGTAGGAGGTGGATAAGATTGAAGGAAGGGTATTTTGGTCAAATT[G/T]
GAATAATATATAGATTTTTTCCTTTTTCCTAAATGAAACCCTAATGGTGTAGTTCAAATAGGGACAAACGATAGGTTCGATTTTAAATTGGTCAAATAAG

Reverse complement sequence

CTTATTTGACCAATTTAAAATCGAACCTATCGTTTGTCCCTATTTGAACTACACCATTAGGGTTTCATTTAGGAAAAAGGAAAAAATCTATATATTATTC[C/A]
AATTTGACCAAAATACCCTTCCTTCAATCTTATCCACCTCCTACCTGCTACCTCCCTGCCTTCAATCTCTTATCATTATCTTTCTCTCACTCTCTTCTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.70% 15.80% 0.23% 59.20% NA
All Indica  2759 35.40% 3.40% 0.14% 61.00% NA
All Japonica  1512 5.70% 38.20% 0.26% 55.82% NA
Aus  269 3.00% 17.80% 0.74% 78.44% NA
Indica I  595 85.70% 6.10% 0.00% 8.24% NA
Indica II  465 19.10% 2.40% 0.00% 78.49% NA
Indica III  913 11.00% 2.10% 0.22% 86.75% NA
Indica Intermediate  786 35.40% 3.70% 0.25% 60.69% NA
Temperate Japonica  767 9.80% 44.50% 0.26% 45.50% NA
Tropical Japonica  504 1.00% 22.60% 0.20% 76.19% NA
Japonica Intermediate  241 2.50% 51.00% 0.41% 46.06% NA
VI/Aromatic  96 68.80% 10.40% 0.00% 20.83% NA
Intermediate  90 35.60% 18.90% 1.11% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206394368 G -> DEL N N silent_mutation Average:65.393; most accessible tissue: Callus, score: 93.722 N N N N
vg1206394368 G -> T LOC_Os12g11780.1 upstream_gene_variant ; 2424.0bp to feature; MODIFIER silent_mutation Average:65.393; most accessible tissue: Callus, score: 93.722 N N N N
vg1206394368 G -> T LOC_Os12g11790.1 upstream_gene_variant ; 114.0bp to feature; MODIFIER silent_mutation Average:65.393; most accessible tissue: Callus, score: 93.722 N N N N
vg1206394368 G -> T LOC_Os12g11790-LOC_Os12g11800 intergenic_region ; MODIFIER silent_mutation Average:65.393; most accessible tissue: Callus, score: 93.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206394368 NA 1.73E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206394368 5.37E-07 1.16E-08 mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206394368 5.44E-07 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206394368 NA 4.46E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251