\
| Variant ID: vg1206187052 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 6187052 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.14, others allele: 0.00, population size: 173. )
CATAAATAGAGATGAAACATTGGGAGCTTATCCTATATAAAAATAGAAGGCATTTCTCAAATATAGATATTAAAATAAAAACATACCTTCATCATCTCCA[C/T]
GTTCTCAATGTAAATAGACTAAATAAGATATAAGACTCAAACAAAACATTAGTCTCACATGCATATGTCAATCACGTGGAAATATTATATATGAACATAT
ATATGTTCATATATAATATTTCCACGTGATTGACATATGCATGTGAGACTAATGTTTTGTTTGAGTCTTATATCTTATTTAGTCTATTTACATTGAGAAC[G/A]
TGGAGATGATGAAGGTATGTTTTTATTTTAATATCTATATTTGAGAAATGCCTTCTATTTTTATATAGGATAAGCTCCCAATGTTTCATCTCTATTTATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 0.90% | 6.54% | 14.47% | NA |
| All Indica | 2759 | 93.10% | 0.80% | 4.93% | 1.16% | NA |
| All Japonica | 1512 | 47.90% | 1.20% | 9.39% | 41.53% | NA |
| Aus | 269 | 86.60% | 1.90% | 7.06% | 4.46% | NA |
| Indica I | 595 | 88.90% | 0.80% | 7.73% | 2.52% | NA |
| Indica II | 465 | 93.30% | 0.20% | 5.59% | 0.86% | NA |
| Indica III | 913 | 97.70% | 0.70% | 1.42% | 0.22% | NA |
| Indica Intermediate | 786 | 91.00% | 1.10% | 6.49% | 1.40% | NA |
| Temperate Japonica | 767 | 59.50% | 0.00% | 1.83% | 38.72% | NA |
| Tropical Japonica | 504 | 26.00% | 3.40% | 22.22% | 48.41% | NA |
| Japonica Intermediate | 241 | 56.80% | 0.40% | 6.64% | 36.10% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 13.33% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1206187052 | C -> DEL | N | N | silent_mutation | Average:12.694; most accessible tissue: Callus, score: 20.372 | N | N | N | N |
| vg1206187052 | C -> T | LOC_Os12g11440.1 | downstream_gene_variant ; 1334.0bp to feature; MODIFIER | silent_mutation | Average:12.694; most accessible tissue: Callus, score: 20.372 | N | N | N | N |
| vg1206187052 | C -> T | LOC_Os12g11440-LOC_Os12g11450 | intergenic_region ; MODIFIER | silent_mutation | Average:12.694; most accessible tissue: Callus, score: 20.372 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1206187052 | NA | 7.66E-06 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206187052 | NA | 9.42E-06 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206187052 | 1.54E-06 | NA | mr1086 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206187052 | NA | 8.79E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206187052 | 7.27E-06 | NA | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206187052 | 4.56E-06 | 9.50E-07 | mr1139 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206187052 | 8.89E-06 | NA | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206187052 | 3.95E-06 | NA | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1206187052 | 1.20E-06 | 2.72E-06 | mr1437 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |