\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206187052:

Variant ID: vg1206187052 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6187052
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.14, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


CATAAATAGAGATGAAACATTGGGAGCTTATCCTATATAAAAATAGAAGGCATTTCTCAAATATAGATATTAAAATAAAAACATACCTTCATCATCTCCA[C/T]
GTTCTCAATGTAAATAGACTAAATAAGATATAAGACTCAAACAAAACATTAGTCTCACATGCATATGTCAATCACGTGGAAATATTATATATGAACATAT

Reverse complement sequence

ATATGTTCATATATAATATTTCCACGTGATTGACATATGCATGTGAGACTAATGTTTTGTTTGAGTCTTATATCTTATTTAGTCTATTTACATTGAGAAC[G/A]
TGGAGATGATGAAGGTATGTTTTTATTTTAATATCTATATTTGAGAAATGCCTTCTATTTTTATATAGGATAAGCTCCCAATGTTTCATCTCTATTTATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 0.90% 6.54% 14.47% NA
All Indica  2759 93.10% 0.80% 4.93% 1.16% NA
All Japonica  1512 47.90% 1.20% 9.39% 41.53% NA
Aus  269 86.60% 1.90% 7.06% 4.46% NA
Indica I  595 88.90% 0.80% 7.73% 2.52% NA
Indica II  465 93.30% 0.20% 5.59% 0.86% NA
Indica III  913 97.70% 0.70% 1.42% 0.22% NA
Indica Intermediate  786 91.00% 1.10% 6.49% 1.40% NA
Temperate Japonica  767 59.50% 0.00% 1.83% 38.72% NA
Tropical Japonica  504 26.00% 3.40% 22.22% 48.41% NA
Japonica Intermediate  241 56.80% 0.40% 6.64% 36.10% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 75.60% 0.00% 13.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206187052 C -> DEL N N silent_mutation Average:12.694; most accessible tissue: Callus, score: 20.372 N N N N
vg1206187052 C -> T LOC_Os12g11440.1 downstream_gene_variant ; 1334.0bp to feature; MODIFIER silent_mutation Average:12.694; most accessible tissue: Callus, score: 20.372 N N N N
vg1206187052 C -> T LOC_Os12g11440-LOC_Os12g11450 intergenic_region ; MODIFIER silent_mutation Average:12.694; most accessible tissue: Callus, score: 20.372 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206187052 NA 7.66E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206187052 NA 9.42E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206187052 1.54E-06 NA mr1086 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206187052 NA 8.79E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206187052 7.27E-06 NA mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206187052 4.56E-06 9.50E-07 mr1139 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206187052 8.89E-06 NA mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206187052 3.95E-06 NA mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206187052 1.20E-06 2.72E-06 mr1437 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251