\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206162924:

Variant ID: vg1206162924 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6162924
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGATATTTAACTTATATCGAAGGAGCCTACGCGTCGGGCGCCTGATGGAGGAGTGGAAAAATCGGACGCTGACGTCACGCATGCGCCAGCACGATGT[T/C]
AGCATGATGCATGCGTGCAAAACCACTAAATTTTTTCTCTTAAATTATTTATCCAAATTATGATTCGATTACACCACTAAATTCATTGCAATTAAATCTT

Reverse complement sequence

AAGATTTAATTGCAATGAATTTAGTGGTGTAATCGAATCATAATTTGGATAAATAATTTAAGAGAAAAAATTTAGTGGTTTTGCACGCATGCATCATGCT[A/G]
ACATCGTGCTGGCGCATGCGTGACGTCAGCGTCCGATTTTTCCACTCCTCCATCAGGCGCCCGACGCGTAGGCTCCTTCGATATAAGTTAAATATCTAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 16.70% 0.55% 34.17% NA
All Indica  2759 68.50% 16.80% 0.18% 14.50% NA
All Japonica  1512 22.90% 6.10% 1.06% 69.97% NA
Aus  269 6.30% 48.30% 0.00% 45.35% NA
Indica I  595 53.30% 19.30% 0.00% 27.39% NA
Indica II  465 77.80% 7.10% 0.00% 15.05% NA
Indica III  913 78.10% 17.60% 0.11% 4.16% NA
Indica Intermediate  786 63.40% 19.70% 0.51% 16.41% NA
Temperate Japonica  767 27.80% 10.40% 1.17% 60.63% NA
Tropical Japonica  504 9.50% 0.80% 1.19% 88.49% NA
Japonica Intermediate  241 35.30% 3.30% 0.41% 61.00% NA
VI/Aromatic  96 10.40% 87.50% 0.00% 2.08% NA
Intermediate  90 36.70% 21.10% 5.56% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206162924 T -> C LOC_Os12g11410.1 upstream_gene_variant ; 2962.0bp to feature; MODIFIER silent_mutation Average:7.239; most accessible tissue: Callus, score: 34.959 N N N N
vg1206162924 T -> C LOC_Os12g11420.1 downstream_gene_variant ; 1511.0bp to feature; MODIFIER silent_mutation Average:7.239; most accessible tissue: Callus, score: 34.959 N N N N
vg1206162924 T -> C LOC_Os12g11410-LOC_Os12g11420 intergenic_region ; MODIFIER silent_mutation Average:7.239; most accessible tissue: Callus, score: 34.959 N N N N
vg1206162924 T -> DEL N N silent_mutation Average:7.239; most accessible tissue: Callus, score: 34.959 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206162924 NA 9.29E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206162924 6.16E-06 4.86E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206162924 8.57E-07 2.32E-06 mr1112_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206162924 NA 1.95E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206162924 6.92E-08 6.92E-08 mr1973_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251