| Variant ID: vg1205863442 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5863442 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, G: 0.25, others allele: 0.00, population size: 209. )
TTTGAAAAAGAAAACTTTCTGTTTGATGAAAATCCTTTCAGATCAAAAGAGTTACCGCTTTCTCTCGTGTGAAAAGAATTTTTTTTCTTAAACTTGTGCC[C/G]
ACAGACCACAGTGTAAAATGCAATTGGAATATCGATCGGCACTCAAGAATCAGTTGTAAGCTACAAAAGATTGTACGATGTCTGCGATTTTTCATCAAGT
ACTTGATGAAAAATCGCAGACATCGTACAATCTTTTGTAGCTTACAACTGATTCTTGAGTGCCGATCGATATTCCAATTGCATTTTACACTGTGGTCTGT[G/C]
GGCACAAGTTTAAGAAAAAAAATTCTTTTCACACGAGAGAAAGCGGTAACTCTTTTGATCTGAAAGGATTTTCATCAAACAGAAAGTTTTCTTTTTCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.10% | 34.40% | 0.38% | 27.04% | NA |
| All Indica | 2759 | 62.40% | 34.80% | 0.18% | 2.61% | NA |
| All Japonica | 1512 | 2.40% | 24.00% | 0.60% | 73.02% | NA |
| Aus | 269 | 3.30% | 68.00% | 0.37% | 28.25% | NA |
| Indica I | 595 | 29.90% | 68.90% | 0.17% | 1.01% | NA |
| Indica II | 465 | 88.00% | 9.50% | 0.43% | 2.15% | NA |
| Indica III | 913 | 77.50% | 19.70% | 0.00% | 2.74% | NA |
| Indica Intermediate | 786 | 54.20% | 41.60% | 0.25% | 3.94% | NA |
| Temperate Japonica | 767 | 1.70% | 33.10% | 0.78% | 64.41% | NA |
| Tropical Japonica | 504 | 4.00% | 5.00% | 0.20% | 90.87% | NA |
| Japonica Intermediate | 241 | 1.20% | 34.90% | 0.83% | 63.07% | NA |
| VI/Aromatic | 96 | 10.40% | 87.50% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 28.90% | 41.10% | 3.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205863442 | C -> DEL | N | N | silent_mutation | Average:37.454; most accessible tissue: Callus, score: 65.115 | N | N | N | N |
| vg1205863442 | C -> G | LOC_Os12g10870.1 | upstream_gene_variant ; 4178.0bp to feature; MODIFIER | silent_mutation | Average:37.454; most accessible tissue: Callus, score: 65.115 | N | N | N | N |
| vg1205863442 | C -> G | LOC_Os12g10880.1 | downstream_gene_variant ; 3015.0bp to feature; MODIFIER | silent_mutation | Average:37.454; most accessible tissue: Callus, score: 65.115 | N | N | N | N |
| vg1205863442 | C -> G | LOC_Os12g10870-LOC_Os12g10880 | intergenic_region ; MODIFIER | silent_mutation | Average:37.454; most accessible tissue: Callus, score: 65.115 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205863442 | NA | 4.70E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205863442 | 9.37E-06 | NA | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205863442 | NA | 2.69E-09 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205863442 | 3.96E-08 | 2.04E-07 | mr1107_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205863442 | 6.54E-06 | 8.79E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |