\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205848936:

Variant ID: vg1205848936 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5848936
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, T: 0.41, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTTTGTTTCCTCACGTGGTTTCCTTTTTGGCACCGCATTACTTTCCTATTTTAGTAAATTTTTGCACCTAAAGTTTTTACATCTTAAATTTACAC[A/T]
TCTAAAGTTTATACACCTAGAGTTTATAGATCCAAAGTTTATAAGTTAAAAGTTTATATACCCGATTCAAATTTGAATTTAAATTTAAATATTTTTTATA

Reverse complement sequence

TATAAAAAATATTTAAATTTAAATTCAAATTTGAATCGGGTATATAAACTTTTAACTTATAAACTTTGGATCTATAAACTCTAGGTGTATAAACTTTAGA[T/A]
GTGTAAATTTAAGATGTAAAAACTTTAGGTGCAAAAATTTACTAAAATAGGAAAGTAATGCGGTGCCAAAAAGGAAACCACGTGAGGAAACAAAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.20% 16.90% 0.32% 57.58% NA
All Indica  2759 37.20% 10.00% 0.36% 52.48% NA
All Japonica  1512 3.40% 20.50% 0.26% 75.86% NA
Aus  269 8.60% 62.50% 0.37% 28.62% NA
Indica I  595 91.60% 2.90% 0.50% 5.04% NA
Indica II  465 18.30% 5.40% 0.65% 75.70% NA
Indica III  913 11.50% 12.00% 0.00% 76.45% NA
Indica Intermediate  786 36.90% 15.80% 0.51% 46.82% NA
Temperate Japonica  767 5.30% 28.20% 0.39% 66.10% NA
Tropical Japonica  504 0.80% 3.60% 0.20% 95.44% NA
Japonica Intermediate  241 2.50% 31.50% 0.00% 65.98% NA
VI/Aromatic  96 68.80% 28.10% 0.00% 3.12% NA
Intermediate  90 31.10% 17.80% 0.00% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205848936 A -> DEL N N silent_mutation Average:25.557; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1205848936 A -> T LOC_Os12g10840.1 upstream_gene_variant ; 1030.0bp to feature; MODIFIER silent_mutation Average:25.557; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1205848936 A -> T LOC_Os12g10850.1 upstream_gene_variant ; 823.0bp to feature; MODIFIER silent_mutation Average:25.557; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1205848936 A -> T LOC_Os12g10840-LOC_Os12g10850 intergenic_region ; MODIFIER silent_mutation Average:25.557; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205848936 NA 8.71E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936 NA 2.37E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936 NA 1.44E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936 NA 1.30E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936 NA 1.29E-20 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936 1.92E-06 6.68E-07 mr1632_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251