| Variant ID: vg1205699586 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5699586 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCCGTTGACTTTTTAAAATATGTTTGACCGTTTGTCTTATTCAAAAATTTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTCATTGTTAAATATA[A/C]
TTTTATGTATACATATAGTTTTACATATTTCATAAAAGTTTTTGAATAAGACGAACAGTTAAACATGTGCTAAAAAGTTAACGGTGTCAAATATTTAGAA
TTCTAAATATTTGACACCGTTAACTTTTTAGCACATGTTTAACTGTTCGTCTTATTCAAAAACTTTTATGAAATATGTAAAACTATATGTATACATAAAA[T/G]
TATATTTAACAATGAATCAAATGATAGAAAAAGAATTAATAATTACTTAAAATTTTTGAATAAGACAAACGGTCAAACATATTTTAAAAAGTCAACGGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.90% | 36.50% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 7.00% | 91.50% | 1.46% | 0.00% | NA |
| Aus | 269 | 63.60% | 36.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.50% | 6.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 11.60% | 85.70% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205699586 | A -> C | LOC_Os12g10660.1 | upstream_gene_variant ; 204.0bp to feature; MODIFIER | silent_mutation | Average:64.358; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg1205699586 | A -> C | LOC_Os12g10650.1 | downstream_gene_variant ; 3308.0bp to feature; MODIFIER | silent_mutation | Average:64.358; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg1205699586 | A -> C | LOC_Os12g10670.1 | downstream_gene_variant ; 3466.0bp to feature; MODIFIER | silent_mutation | Average:64.358; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg1205699586 | A -> C | LOC_Os12g10650-LOC_Os12g10660 | intergenic_region ; MODIFIER | silent_mutation | Average:64.358; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205699586 | NA | 7.40E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205699586 | NA | 8.48E-14 | mr1281 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205699586 | NA | 9.41E-13 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205699586 | NA | 4.45E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205699586 | NA | 1.48E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |