Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1205373977:

Variant ID: vg1205373977 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5373977
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAGAGAAGAGAGATGATGTATTTATTAATGGCCCACTCTAAGAAATCATGGGTTGTGGAGTGTAGTTTCTATTGTGATGTCTTATTGACATGGCACCAT[G/A]
GACACTACTTATGGACACTATGGGTTGGGACTGCCCTAATCATTGGGTTGGGAATGGCCTAATACTACTACCACTAGTACATTATTACTACTACTAGTAA

Reverse complement sequence

TTACTAGTAGTAGTAATAATGTACTAGTGGTAGTAGTATTAGGCCATTCCCAACCCAATGATTAGGGCAGTCCCAACCCATAGTGTCCATAAGTAGTGTC[C/T]
ATGGTGCCATGTCAATAAGACATCACAATAGAAACTACACTCCACAACCCATGATTTCTTAGAGTGGGCCATTAATAAATACATCATCTCTCTTCTCTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.60%	0.20%	0.63%	57.51%	NA
All Indica	2759	10.70%	0.20%	0.94%	88.15%	NA
All Japonica	1512	95.00%	0.00%	0.07%	4.89%	NA
Aus	269	28.60%	1.10%	0.74%	69.52%	NA
Indica I	595	12.80%	0.00%	1.68%	85.55%	NA
Indica II	465	13.10%	0.20%	0.86%	85.81%	NA
Indica III	913	6.40%	0.00%	0.33%	93.32%	NA
Indica Intermediate	786	12.80%	0.50%	1.15%	85.50%	NA
Temperate Japonica	767	96.70%	0.00%	0.00%	3.26%	NA
Tropical Japonica	504	95.20%	0.00%	0.00%	4.76%	NA
Japonica Intermediate	241	89.20%	0.00%	0.41%	10.37%	NA
VI/Aromatic	96	94.80%	2.10%	0.00%	3.12%	NA
Intermediate	90	74.40%	0.00%	1.11%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205373977	G -> DEL	N	N	silent_mutation	Average:12.78; most accessible tissue: Callus, score: 43.78	N	N	N	N
vg1205373977	G -> A	LOC_Os12g10160.1	upstream_gene_variant ; 1817.0bp to feature; MODIFIER	silent_mutation	Average:12.78; most accessible tissue: Callus, score: 43.78	N	N	N	N
vg1205373977	G -> A	LOC_Os12g10170.1	upstream_gene_variant ; 1141.0bp to feature; MODIFIER	silent_mutation	Average:12.78; most accessible tissue: Callus, score: 43.78	N	N	N	N
vg1205373977	G -> A	LOC_Os12g10150.1	downstream_gene_variant ; 3815.0bp to feature; MODIFIER	silent_mutation	Average:12.78; most accessible tissue: Callus, score: 43.78	N	N	N	N
vg1205373977	G -> A	LOC_Os12g10180.1	downstream_gene_variant ; 2889.0bp to feature; MODIFIER	silent_mutation	Average:12.78; most accessible tissue: Callus, score: 43.78	N	N	N	N
vg1205373977	G -> A	LOC_Os12g10160-LOC_Os12g10170	intergenic_region ; MODIFIER	silent_mutation	Average:12.78; most accessible tissue: Callus, score: 43.78	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205373977	5.21E-08	6.82E-10	mr1350_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205373977	8.95E-06	8.95E-06	mr1456_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251