\
| Variant ID: vg1205368460 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5368460 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.36, others allele: 0.00, population size: 63. )
CGCGCATCAACGGTGATGGCAAAATCCACCAATCATGAAGATGAAGAAAATAGTCGGCGACGGCAAACGCATCCGACGGTAATGATGATTAGCGGCAACA[A/G]
AGATAGCCGGCTATGGTGACGAAGTTGCCCATCAACGGCAGCAGTGTAGGCTATGTTGAAGAGGCTTGACAGGATGTTGATGAAGATGACGATGCCGGCG
CGCCGGCATCGTCATCTTCATCAACATCCTGTCAAGCCTCTTCAACATAGCCTACACTGCTGCCGTTGATGGGCAACTTCGTCACCATAGCCGGCTATCT[T/C]
TGTTGCCGCTAATCATCATTACCGTCGGATGCGTTTGCCGTCGCCGACTATTTTCTTCATCTTCATGATTGGTGGATTTTGCCATCACCGTTGATGCGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.20% | 2.60% | 3.98% | 52.20% | NA |
| All Indica | 2759 | 10.50% | 4.40% | 6.45% | 78.62% | NA |
| All Japonica | 1512 | 95.00% | 0.00% | 0.46% | 4.56% | NA |
| Aus | 269 | 23.80% | 0.40% | 0.74% | 75.09% | NA |
| Indica I | 595 | 13.30% | 0.30% | 2.69% | 83.70% | NA |
| Indica II | 465 | 14.00% | 6.70% | 7.74% | 71.61% | NA |
| Indica III | 913 | 4.90% | 4.70% | 8.21% | 82.15% | NA |
| Indica Intermediate | 786 | 13.00% | 5.70% | 6.49% | 74.81% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 0.13% | 3.26% | NA |
| Tropical Japonica | 504 | 95.20% | 0.00% | 0.60% | 4.17% | NA |
| Japonica Intermediate | 241 | 89.20% | 0.00% | 1.24% | 9.54% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 73.30% | 0.00% | 1.11% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205368460 | A -> DEL | N | N | silent_mutation | Average:17.412; most accessible tissue: Callus, score: 45.231 | N | N | N | N |
| vg1205368460 | A -> G | LOC_Os12g10150.1 | upstream_gene_variant ; 1466.0bp to feature; MODIFIER | silent_mutation | Average:17.412; most accessible tissue: Callus, score: 45.231 | N | N | N | N |
| vg1205368460 | A -> G | LOC_Os12g10140.1 | downstream_gene_variant ; 2646.0bp to feature; MODIFIER | silent_mutation | Average:17.412; most accessible tissue: Callus, score: 45.231 | N | N | N | N |
| vg1205368460 | A -> G | LOC_Os12g10160.1 | downstream_gene_variant ; 2816.0bp to feature; MODIFIER | silent_mutation | Average:17.412; most accessible tissue: Callus, score: 45.231 | N | N | N | N |
| vg1205368460 | A -> G | LOC_Os12g10140-LOC_Os12g10150 | intergenic_region ; MODIFIER | silent_mutation | Average:17.412; most accessible tissue: Callus, score: 45.231 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205368460 | NA | 5.24E-16 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205368460 | NA | 4.55E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205368460 | NA | 8.34E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205368460 | NA | 2.59E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205368460 | 1.04E-06 | NA | mr1301 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205368460 | NA | 4.27E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205368460 | NA | 1.67E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205368460 | NA | 8.96E-21 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205368460 | NA | 2.95E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205368460 | NA | 7.47E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |