\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205368460:

Variant ID: vg1205368460 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 5368460
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.36, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGCATCAACGGTGATGGCAAAATCCACCAATCATGAAGATGAAGAAAATAGTCGGCGACGGCAAACGCATCCGACGGTAATGATGATTAGCGGCAACA[A/G]
AGATAGCCGGCTATGGTGACGAAGTTGCCCATCAACGGCAGCAGTGTAGGCTATGTTGAAGAGGCTTGACAGGATGTTGATGAAGATGACGATGCCGGCG

Reverse complement sequence

CGCCGGCATCGTCATCTTCATCAACATCCTGTCAAGCCTCTTCAACATAGCCTACACTGCTGCCGTTGATGGGCAACTTCGTCACCATAGCCGGCTATCT[T/C]
TGTTGCCGCTAATCATCATTACCGTCGGATGCGTTTGCCGTCGCCGACTATTTTCTTCATCTTCATGATTGGTGGATTTTGCCATCACCGTTGATGCGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 2.60% 3.98% 52.20% NA
All Indica  2759 10.50% 4.40% 6.45% 78.62% NA
All Japonica  1512 95.00% 0.00% 0.46% 4.56% NA
Aus  269 23.80% 0.40% 0.74% 75.09% NA
Indica I  595 13.30% 0.30% 2.69% 83.70% NA
Indica II  465 14.00% 6.70% 7.74% 71.61% NA
Indica III  913 4.90% 4.70% 8.21% 82.15% NA
Indica Intermediate  786 13.00% 5.70% 6.49% 74.81% NA
Temperate Japonica  767 96.60% 0.00% 0.13% 3.26% NA
Tropical Japonica  504 95.20% 0.00% 0.60% 4.17% NA
Japonica Intermediate  241 89.20% 0.00% 1.24% 9.54% NA
VI/Aromatic  96 94.80% 1.00% 0.00% 4.17% NA
Intermediate  90 73.30% 0.00% 1.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1205368460 A -> DEL N N silent_mutation Average:17.412; most accessible tissue: Callus, score: 45.231 N N N N
vg1205368460 A -> G LOC_Os12g10150.1 upstream_gene_variant ; 1466.0bp to feature; MODIFIER silent_mutation Average:17.412; most accessible tissue: Callus, score: 45.231 N N N N
vg1205368460 A -> G LOC_Os12g10140.1 downstream_gene_variant ; 2646.0bp to feature; MODIFIER silent_mutation Average:17.412; most accessible tissue: Callus, score: 45.231 N N N N
vg1205368460 A -> G LOC_Os12g10160.1 downstream_gene_variant ; 2816.0bp to feature; MODIFIER silent_mutation Average:17.412; most accessible tissue: Callus, score: 45.231 N N N N
vg1205368460 A -> G LOC_Os12g10140-LOC_Os12g10150 intergenic_region ; MODIFIER silent_mutation Average:17.412; most accessible tissue: Callus, score: 45.231 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1205368460 NA 5.24E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460 NA 4.55E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460 NA 8.34E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460 NA 2.59E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460 1.04E-06 NA mr1301 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460 NA 4.27E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460 NA 1.67E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460 NA 8.96E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460 NA 2.95E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460 NA 7.47E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251