Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1205368460:

Variant ID: vg1205368460 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5368460
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.36, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

CGCGCATCAACGGTGATGGCAAAATCCACCAATCATGAAGATGAAGAAAATAGTCGGCGACGGCAAACGCATCCGACGGTAATGATGATTAGCGGCAACA[A/G]
AGATAGCCGGCTATGGTGACGAAGTTGCCCATCAACGGCAGCAGTGTAGGCTATGTTGAAGAGGCTTGACAGGATGTTGATGAAGATGACGATGCCGGCG

Reverse complement sequence

CGCCGGCATCGTCATCTTCATCAACATCCTGTCAAGCCTCTTCAACATAGCCTACACTGCTGCCGTTGATGGGCAACTTCGTCACCATAGCCGGCTATCT[T/C]
TGTTGCCGCTAATCATCATTACCGTCGGATGCGTTTGCCGTCGCCGACTATTTTCTTCATCTTCATGATTGGTGGATTTTGCCATCACCGTTGATGCGCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.20%	2.60%	3.98%	52.20%	NA
All Indica	2759	10.50%	4.40%	6.45%	78.62%	NA
All Japonica	1512	95.00%	0.00%	0.46%	4.56%	NA
Aus	269	23.80%	0.40%	0.74%	75.09%	NA
Indica I	595	13.30%	0.30%	2.69%	83.70%	NA
Indica II	465	14.00%	6.70%	7.74%	71.61%	NA
Indica III	913	4.90%	4.70%	8.21%	82.15%	NA
Indica Intermediate	786	13.00%	5.70%	6.49%	74.81%	NA
Temperate Japonica	767	96.60%	0.00%	0.13%	3.26%	NA
Tropical Japonica	504	95.20%	0.00%	0.60%	4.17%	NA
Japonica Intermediate	241	89.20%	0.00%	1.24%	9.54%	NA
VI/Aromatic	96	94.80%	1.00%	0.00%	4.17%	NA
Intermediate	90	73.30%	0.00%	1.11%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205368460	A -> DEL	N	N	silent_mutation	Average:17.412; most accessible tissue: Callus, score: 45.231	N	N	N	N
vg1205368460	A -> G	LOC_Os12g10150.1	upstream_gene_variant ; 1466.0bp to feature; MODIFIER	silent_mutation	Average:17.412; most accessible tissue: Callus, score: 45.231	N	N	N	N
vg1205368460	A -> G	LOC_Os12g10140.1	downstream_gene_variant ; 2646.0bp to feature; MODIFIER	silent_mutation	Average:17.412; most accessible tissue: Callus, score: 45.231	N	N	N	N
vg1205368460	A -> G	LOC_Os12g10160.1	downstream_gene_variant ; 2816.0bp to feature; MODIFIER	silent_mutation	Average:17.412; most accessible tissue: Callus, score: 45.231	N	N	N	N
vg1205368460	A -> G	LOC_Os12g10140-LOC_Os12g10150	intergenic_region ; MODIFIER	silent_mutation	Average:17.412; most accessible tissue: Callus, score: 45.231	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205368460	NA	5.24E-16	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460	NA	4.55E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460	NA	8.34E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460	NA	2.59E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460	1.04E-06	NA	mr1301	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460	NA	4.27E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460	NA	1.67E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460	NA	8.96E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460	NA	2.95E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205368460	NA	7.47E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251