Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1205262287:

Variant ID: vg1205262287 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5262287
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATTATAATAGAGAGAACCAAGCTAATATTTATATGTTACTTGTAATAATTATGTCTAAGCAGGGGTTAAGATAAGCATAGGGTAGAGTGACACACAAG[G/C]
ATAAGACTACTCACTCTCATATTAAATTATCTGAGCTAAGTGGAAAGAAAATAGAAAAGAATCTATTCCTATACTTCTAGTATACATATTATACATACAT

Reverse complement sequence

ATGTATGTATAATATGTATACTAGAAGTATAGGAATAGATTCTTTTCTATTTTCTTTCCACTTAGCTCAGATAATTTAATATGAGAGTGAGTAGTCTTAT[C/G]
CTTGTGTGTCACTCTACCCTATGCTTATCTTAACCCCTGCTTAGACATAATTATTACAAGTAACATATAAATATTAGCTTGGTTCTCTCTATTATAATCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	0.30%	1.04%	43.25%	NA
All Indica	2759	30.80%	0.50%	1.74%	66.94%	NA
All Japonica	1512	98.30%	0.00%	0.07%	1.65%	NA
Aus	269	43.10%	0.00%	0.00%	56.88%	NA
Indica I	595	55.30%	0.00%	1.51%	43.19%	NA
Indica II	465	35.50%	0.40%	2.80%	61.29%	NA
Indica III	913	7.00%	1.00%	1.64%	90.36%	NA
Indica Intermediate	786	37.30%	0.30%	1.40%	61.07%	NA
Temperate Japonica	767	99.00%	0.00%	0.13%	0.91%	NA
Tropical Japonica	504	97.60%	0.00%	0.00%	2.38%	NA
Japonica Intermediate	241	97.50%	0.00%	0.00%	2.49%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	82.20%	0.00%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205262287	G -> C	LOC_Os12g09920.1	upstream_gene_variant ; 3424.0bp to feature; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 27.652	N	N	N	N
vg1205262287	G -> C	LOC_Os12g09930.1	upstream_gene_variant ; 2067.0bp to feature; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 27.652	N	N	N	N
vg1205262287	G -> C	LOC_Os12g09940.1	upstream_gene_variant ; 359.0bp to feature; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 27.652	N	N	N	N
vg1205262287	G -> C	LOC_Os12g09954.1	downstream_gene_variant ; 2715.0bp to feature; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 27.652	N	N	N	N
vg1205262287	G -> C	LOC_Os12g09940-LOC_Os12g09954	intergenic_region ; MODIFIER	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 27.652	N	N	N	N
vg1205262287	G -> DEL	N	N	silent_mutation	Average:14.577; most accessible tissue: Callus, score: 27.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205262287	9.91E-07	NA	mr1023_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205262287	NA	2.87E-07	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205262287	8.61E-06	3.12E-08	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205262287	NA	1.64E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251