\
| Variant ID: vg1204926524 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4926524 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 54. )
TCTCCTGAGGAAGAGGTTAAGTTCGAGGCTTCGGATTTCCTGTTCCGTGGAGCATTGATCAGTGTACTCGCTGACAATATAGTGGACGTGTATATGCACA[C/T,A]
GCCTTCAGGGAAGGACATGTGGGATGCACTTGAGGCCAAGTTCGGAGTTTCCGACGCCGGCAGTGAGCTGTATGTCATGGAGTAGTTCTATGACTACAAG
CTTGTAGTCATAGAACTACTCCATGACATACAGCTCACTGCCGGCGTCGGAAACTCCGAACTTGGCCTCAAGTGCATCCCACATGTCCTTCCCTGAAGGC[G/A,T]
TGTGCATATACACGTCCACTATATTGTCAGCGAGTACACTGATCAATGCTCCACGGAACAGGAAATCCGAAGCCTCGAACTTAACCTCTTCCTCAGGAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 46.80% | 0.17% | 0.00% | A: 0.02% |
| All Indica | 2759 | 89.10% | 10.70% | 0.25% | 0.00% | A: 0.04% |
| All Japonica | 1512 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.70% | 12.80% | 0.50% | 0.00% | NA |
| Indica II | 465 | 93.50% | 6.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 93.60% | 5.90% | 0.33% | 0.00% | A: 0.11% |
| Indica Intermediate | 786 | 82.80% | 17.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 27.80% | 71.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204926524 | C -> A | LOC_Os12g09400.1 | missense_variant ; p.Thr99Lys; MODERATE | nonsynonymous_codon ; T99K | Average:16.176; most accessible tissue: Callus, score: 34.202 | benign |
0.165 |
DELETERIOUS | 0.00 |
| vg1204926524 | C -> T | LOC_Os12g09400.1 | missense_variant ; p.Thr99Met; MODERATE | nonsynonymous_codon ; T99M | Average:16.176; most accessible tissue: Callus, score: 34.202 | benign |
-1.445 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204926524 | NA | 7.02E-06 | mr1006 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 4.88E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 1.43E-28 | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 4.09E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 9.63E-33 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 2.59E-14 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 4.36E-06 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 2.31E-11 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 3.19E-31 | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 1.40E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 7.02E-06 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 2.41E-31 | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 9.45E-06 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204926524 | NA | 3.37E-16 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |