\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204785483:

Variant ID: vg1204785483 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4785483
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACCCTAGTGATCGAGGCTTGGGTAGTCCTCTCCGTGGGCCGGTTCCCACCTTGCCCACTCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGC[A/G]
GTGGAGTTAGGCTCGCCTCAATGAGGATTAGGAAACCGGTGAGTTTCCGAACCTCGGTGAAAAATTCCTTGTCTCTTGTCTCATTTATTTGTTGCATTTA

Reverse complement sequence

TAAATGCAACAAATAAATGAGACAAGAGACAAGGAATTTTTCACCGAGGTTCGGAAACTCACCGGTTTCCTAATCCTCATTGAGGCGAGCCTAACTCCAC[T/C]
GCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGAGTGGGCAAGGTGGGAACCGGCCCACGGAGAGGACTACCCAAGCCTCGATCACTAGGGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.30% 0.15% 0.00% NA
All Indica  2759 96.70% 3.30% 0.07% 0.00% NA
All Japonica  1512 13.00% 87.00% 0.00% 0.00% NA
Aus  269 56.50% 42.80% 0.74% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.00% 0.13% 0.00% NA
Temperate Japonica  767 5.00% 95.00% 0.00% 0.00% NA
Tropical Japonica  504 10.90% 89.10% 0.00% 0.00% NA
Japonica Intermediate  241 42.70% 57.30% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 94.80% 2.08% 0.00% NA
Intermediate  90 36.70% 62.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204785483 A -> G LOC_Os12g09150.1 upstream_gene_variant ; 2149.0bp to feature; MODIFIER silent_mutation Average:56.867; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg1204785483 A -> G LOC_Os12g09140.1 downstream_gene_variant ; 2558.0bp to feature; MODIFIER silent_mutation Average:56.867; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg1204785483 A -> G LOC_Os12g09140-LOC_Os12g09150 intergenic_region ; MODIFIER silent_mutation Average:56.867; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204785483 NA 7.18E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 2.53E-07 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 NA 8.69E-08 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 3.51E-06 NA mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 8.82E-06 5.28E-12 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 NA 4.81E-07 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 NA 7.51E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 NA 8.31E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 NA 1.52E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 3.67E-10 NA mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 NA 5.85E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 1.50E-07 NA mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 5.92E-06 7.30E-10 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 2.79E-08 NA mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204785483 1.01E-06 4.57E-10 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251