\
| Variant ID: vg1204785483 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4785483 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTACCCTAGTGATCGAGGCTTGGGTAGTCCTCTCCGTGGGCCGGTTCCCACCTTGCCCACTCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGC[A/G]
GTGGAGTTAGGCTCGCCTCAATGAGGATTAGGAAACCGGTGAGTTTCCGAACCTCGGTGAAAAATTCCTTGTCTCTTGTCTCATTTATTTGTTGCATTTA
TAAATGCAACAAATAAATGAGACAAGAGACAAGGAATTTTTCACCGAGGTTCGGAAACTCACCGGTTTCCTAATCCTCATTGAGGCGAGCCTAACTCCAC[T/C]
GCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGAGTGGGCAAGGTGGGAACCGGCCCACGGAGAGGACTACCCAAGCCTCGATCACTAGGGTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 35.30% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 96.70% | 3.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 13.00% | 87.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 56.50% | 42.80% | 0.74% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 5.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.90% | 89.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 94.80% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 62.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204785483 | A -> G | LOC_Os12g09150.1 | upstream_gene_variant ; 2149.0bp to feature; MODIFIER | silent_mutation | Average:56.867; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| vg1204785483 | A -> G | LOC_Os12g09140.1 | downstream_gene_variant ; 2558.0bp to feature; MODIFIER | silent_mutation | Average:56.867; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| vg1204785483 | A -> G | LOC_Os12g09140-LOC_Os12g09150 | intergenic_region ; MODIFIER | silent_mutation | Average:56.867; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204785483 | NA | 7.18E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | 2.53E-07 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | NA | 8.69E-08 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | 3.51E-06 | NA | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | 8.82E-06 | 5.28E-12 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | NA | 4.81E-07 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | NA | 7.51E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | NA | 8.31E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | NA | 1.52E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | 3.67E-10 | NA | mr1679_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | NA | 5.85E-08 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | 1.50E-07 | NA | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | 5.92E-06 | 7.30E-10 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | 2.79E-08 | NA | mr1720_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204785483 | 1.01E-06 | 4.57E-10 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |