\
| Variant ID: vg1204723475 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4723475 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCATGAAAGCGAAGACTCCATGGATAGCGGCGAAGGCTAGCCGGGGTGAAGACATAGAGGCCCATCAACGGTGGTGTGACCAACCAATCGTGAATGCGA[T/G]
GACACCAGTCGGCGGTGACGGAGGCAAGCCGACGTTGAAGATGTATGTGCCCATCGATGGCGGTGTGACCAACCAGCCGTGTAGGCGAAGGTACTAGTAG
CTACTAGTACCTTCGCCTACACGGCTGGTTGGTCACACCGCCATCGATGGGCACATACATCTTCAACGTCGGCTTGCCTCCGTCACCGCCGACTGGTGTC[A/C]
TCGCATTCACGATTGGTTGGTCACACCACCGTTGATGGGCCTCTATGTCTTCACCCCGGCTAGCCTTCGCCGCTATCCATGGAGTCTTCGCTTTCATGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 33.50% | 0.13% | 0.21% | NA |
| All Indica | 2759 | 97.30% | 2.40% | 0.07% | 0.29% | NA |
| All Japonica | 1512 | 12.40% | 87.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.40% | 1.20% | 0.11% | 0.33% | NA |
| Indica Intermediate | 786 | 95.20% | 4.30% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 8.70% | 91.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.40% | 54.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 58.90% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204723475 | T -> DEL | N | N | silent_mutation | Average:65.259; most accessible tissue: Zhenshan97 young leaf, score: 87.153 | N | N | N | N |
| vg1204723475 | T -> G | LOC_Os12g09030.1 | upstream_gene_variant ; 1664.0bp to feature; MODIFIER | silent_mutation | Average:65.259; most accessible tissue: Zhenshan97 young leaf, score: 87.153 | N | N | N | N |
| vg1204723475 | T -> G | LOC_Os12g09030-LOC_Os12g09050 | intergenic_region ; MODIFIER | silent_mutation | Average:65.259; most accessible tissue: Zhenshan97 young leaf, score: 87.153 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204723475 | NA | 2.47E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | 1.39E-06 | 1.48E-08 | mr1120 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | NA | 7.49E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | NA | 3.72E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | NA | 8.72E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | 2.16E-06 | NA | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | 8.03E-08 | 7.69E-10 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | 5.35E-07 | NA | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | 1.17E-08 | 1.05E-13 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | 1.50E-06 | 5.66E-08 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | NA | 8.45E-07 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | NA | 7.47E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | NA | 7.90E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | 1.38E-06 | NA | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | 4.46E-06 | 2.14E-09 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204723475 | NA | 3.77E-08 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |