Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204671475:

Variant ID: vg1204671475 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4671475
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGTCTATTCCCGAGGCATGGGAACGACTACAGGAGTATATGGCCGCCTGTCCTCATCATGGGATGGACGACTGGCTGATCCTGCAGAACTTTTACACT[T/A]
GGTTCACTCCTACGTCTCGCGACCACCTGGACACGGTAGCTAGAGGAGCCTTTTTCTCTAAGACGGTTTGAGGAGCCATCGACTTGATAGAGAAAATCTT

Reverse complement sequence

AAGATTTTCTCTATCAAGTCGATGGCTCCTCAAACCGTCTTAGAGAAAAAGGCTCCTCTAGCTACCGTGTCCAGGTGGTCGCGAGACGTAGGAGTGAACC[A/T]
AGTGTAAAAGTTCTGCAGGATCAGCCAGTCGTCCATCCCATGATGAGGACAGGCGGCCATATACTCCTGTAGTCGTTCCCATGCCTCGGGAATAGACTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.00%	33.60%	1.23%	1.14%	NA
All Indica	2759	93.80%	2.40%	1.81%	1.92%	NA
All Japonica	1512	12.60%	87.20%	0.20%	0.00%	NA
Aus	269	76.60%	23.00%	0.37%	0.00%	NA
Indica I	595	92.40%	1.00%	3.87%	2.69%	NA
Indica II	465	93.50%	3.20%	1.94%	1.29%	NA
Indica III	913	95.90%	1.20%	0.99%	1.86%	NA
Indica Intermediate	786	92.60%	4.50%	1.15%	1.78%	NA
Temperate Japonica	767	5.20%	94.80%	0.00%	0.00%	NA
Tropical Japonica	504	8.70%	91.10%	0.20%	0.00%	NA
Japonica Intermediate	241	44.00%	55.20%	0.83%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	36.70%	57.80%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204671475	T -> DEL	N	N	silent_mutation	Average:63.102; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg1204671475	T -> A	LOC_Os12g08940.1	downstream_gene_variant ; 2328.0bp to feature; MODIFIER	silent_mutation	Average:63.102; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg1204671475	T -> A	LOC_Os12g08950.1	downstream_gene_variant ; 183.0bp to feature; MODIFIER	silent_mutation	Average:63.102; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg1204671475	T -> A	LOC_Os12g08950-LOC_Os12g08960	intergenic_region ; MODIFIER	silent_mutation	Average:63.102; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204671475	NA	1.36E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	2.31E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	9.20E-07	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	5.29E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	3.70E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	8.19E-06	NA	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	6.69E-06	1.12E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	3.63E-08	NA	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	1.36E-08	1.18E-11	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	1.42E-09	NA	mr1693	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	5.28E-10	1.43E-16	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	1.03E-06	2.43E-09	mr1720	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	2.64E-07	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	2.76E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	5.53E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	7.38E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	3.22E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	6.23E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	7.05E-08	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	1.89E-06	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	4.84E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	5.81E-06	NA	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	7.98E-06	4.65E-09	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475	NA	1.80E-07	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251