\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204671475:

Variant ID: vg1204671475 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4671475
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGTCTATTCCCGAGGCATGGGAACGACTACAGGAGTATATGGCCGCCTGTCCTCATCATGGGATGGACGACTGGCTGATCCTGCAGAACTTTTACACT[T/A]
GGTTCACTCCTACGTCTCGCGACCACCTGGACACGGTAGCTAGAGGAGCCTTTTTCTCTAAGACGGTTTGAGGAGCCATCGACTTGATAGAGAAAATCTT

Reverse complement sequence

AAGATTTTCTCTATCAAGTCGATGGCTCCTCAAACCGTCTTAGAGAAAAAGGCTCCTCTAGCTACCGTGTCCAGGTGGTCGCGAGACGTAGGAGTGAACC[A/T]
AGTGTAAAAGTTCTGCAGGATCAGCCAGTCGTCCATCCCATGATGAGGACAGGCGGCCATATACTCCTGTAGTCGTTCCCATGCCTCGGGAATAGACTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 33.60% 1.23% 1.14% NA
All Indica  2759 93.80% 2.40% 1.81% 1.92% NA
All Japonica  1512 12.60% 87.20% 0.20% 0.00% NA
Aus  269 76.60% 23.00% 0.37% 0.00% NA
Indica I  595 92.40% 1.00% 3.87% 2.69% NA
Indica II  465 93.50% 3.20% 1.94% 1.29% NA
Indica III  913 95.90% 1.20% 0.99% 1.86% NA
Indica Intermediate  786 92.60% 4.50% 1.15% 1.78% NA
Temperate Japonica  767 5.20% 94.80% 0.00% 0.00% NA
Tropical Japonica  504 8.70% 91.10% 0.20% 0.00% NA
Japonica Intermediate  241 44.00% 55.20% 0.83% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 36.70% 57.80% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204671475 T -> DEL N N silent_mutation Average:63.102; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg1204671475 T -> A LOC_Os12g08940.1 downstream_gene_variant ; 2328.0bp to feature; MODIFIER silent_mutation Average:63.102; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg1204671475 T -> A LOC_Os12g08950.1 downstream_gene_variant ; 183.0bp to feature; MODIFIER silent_mutation Average:63.102; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg1204671475 T -> A LOC_Os12g08950-LOC_Os12g08960 intergenic_region ; MODIFIER silent_mutation Average:63.102; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204671475 NA 1.36E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 2.31E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 9.20E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 5.29E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 3.70E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 8.19E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 6.69E-06 1.12E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 3.63E-08 NA mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 1.36E-08 1.18E-11 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 1.42E-09 NA mr1693 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 5.28E-10 1.43E-16 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 1.03E-06 2.43E-09 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 2.64E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 2.76E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 5.53E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 7.38E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 3.22E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 6.23E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 7.05E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 1.89E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 4.84E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 5.81E-06 NA mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 7.98E-06 4.65E-09 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671475 NA 1.80E-07 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251